Parasite Pill 2.0

This report is dedicated to those mighty goats who fight valiantly for the freedom to speak their mind.

& Second Edition

1. IMMUNE exp e ————Á—Ó 4

2S ERE ВВА Масата ооло tere een sgn ancora eae 22
3. ЅҮМРТОМ5 .................... дДҙҘҙә1 М... аннан 26
4. РАВАЅІТЕС......... РИ... анаа КТ 30
ЖАаНПҺ4--- ЖҰРТ OM оо, , МЕТ 60
6. THE МОВКЕНФ, ЕЛ M 0 А .522.).......................................... 89
7. THE DRONES.............. ДЧ E ЛЫСЫ ененин 132
8. THE QUEEN Ы ҚЫН аа ОКК ........... 140
9. TRUTH AS НЕНОЙ eno OO Oe ИЛ ао a oaaao aooe: 148
10. КА МАМА КАА ІЛ/ЕВАМА............2. емле йа ме ымен sensen немене setot nenat 153
11 DEWORMING а 157
12 TREATMENTS н. 165

par-a-site

[pere sit] %)

NOUN

1. anorganism that lives in or on an organism of another species (its host) and benefits
by deriving nutrients at the other's expense:

"the parasite attaches itself to the mouths of fishes" - [more]

Taxonomic range [edit]

Parasitism has an extremely wide taxonomic range, including animals, plants, fungi, protozoans, bacteria, and уігиѕеѕ 155

Head
DNA
Ш | Collar
Protein
Tail
Long Tail

Fibres

2D 3D

Tapeworm

Base Plate

1. IMMUNE SYSTEM

Cats have a schedule for routine treatment of parasites.
Dogs have a schedule for routine treatment of parasites.
Horses have a schedule for routine treatment of parasites.
Cattle have a schedule for routine treatment of parasites.
Chickens have a schedule for routine treatment of parasites.

All mammals that interact with humans have a schedule for
routine treatment of parasites.

Except for one...

Are you a mammal?

Do you interact with humans?

When was the last time you were prescribed a schedule for a routine treatment of parasites?

The immune system of all mammals naturally fights off parasites.

Yet, all mammals [except one] are still given a schedule for routine treatment of parasites.

But how does the human immune system compare with the immune system of other mammals?
Reconcile.

Is Vitamin C necessary for a healthy immune system?
Which is the only mammal incapable of producing its own Vitamin C?
What is 'hypoascorbemia'?

If humans cannot naturally produce Vitamin C, would humans be more
susceptible to parasite infection than any other mammal?

If humans are more susceptible to parasite infection than all other mammals, then why are humans the only
mammal which is not given a schedule for routine treatment of parasites?

Logical thinking.

№

Female

“=e

Egg-mass

Does Vitamin C deficiency result in depression, schizophrenia, Alzheimer’s disease, gastrointestinal disease,
fatigue, death, and even cancer?

Preventive and Therapeutic Potential of Vitamin C in...
https://pubmed.ncbi.nlm.nih.gov/30074145

In the past few decades, scientists have revealed that the deficiency of vitamin C may lead to
motor deficit, cognitive impairment and aberrant behaviors, whereas supplement of vitamin C

has a potential preventive and therapeutic effect on mental illness, such as major depressive

disorder (MDD), schizophrenia, anxiety and Alzheimer's disease (AD)
Author: Qian-Qian Han, Tian-Tian Shen, Fan Publish Year: 2018

Do these symptoms result from a vitamin deficiently, or are these symptoms resulting from parasites rapidly
multiplying in a host with an immune system weakened from vitamin deficiency?

What is the [real] cause of depression, schizophrenia, Alzheimer's disease, gastrointestinal disease, fatigue,
death, and cancer?

It gets worse.

What is Teetotalism?
Why is alcohol so fervently pushed upon society?
Does alcohol prevent the body's absorption of Vitamin C?

@ sciencedaily.com/releases/2016/05/160512085348.htm

Chronic drinking interferes with absorption of critical vita-
mins by pancreas

Date: May 12, 2016
Source: American Physiological Society (APS)

Summary: Chronic exposure to alcohol interferes with the pancreas’ ability to absorb vitamin C, po-
tentially predisposing the body to pancreatitis and other pancreatic diseases, a new
study reports. The findings provide a link between chronic alcohol use and poor pancre-
atic health.

Does it damage the blood-brain barrier making the brain susceptible to parasitic infection?
pubmed.ncbi.nim.nih.gov/33799986/

Alcohol-Induced Blood-Brain Barrier Impairment:
An In Vitro Study

Donatello Carrino 1, Jacopo Junio Valerio Branca 1, Matteo Becatti 2, Ferdinando Paternostro !
Gabriele Morucci 3, Massimo Gulisano 1, Lorenzo Di Cesare Mannelli ^, Alessandra Pacini !

Affiliations + expand
PMID: 33799986 PMCID: PMC7967408 DOI: 10.3390/ijerph18052683
Free PMC article

Abstract

In recent years, alcohol abuse has dramatically grown with deleterious consequence for people's
health and, in turn, for health care costs. it has been demonstrated, in humans and animals, that
alcohol intoxication induces neuroinflammation and neurodegeneration thus leading to brain
impairments. Furthermore, it has been shown that
(BBB), but the molecular mechanisms underlining this detrimental effect have not been
fully elucidated. For this reason, in this study we investigated the effects of alcohol exposure on a rat

If a mammal is unable to produce its own Vitamin C, and if
that mammal is given a substance which prevents the body's
absorption of Vitamin C, will that mammal suffer from a
dramatically compromised immune system?

Would parasites thrive in such a host?

What is the [real] purpose for promoting alcohol consumption?

It gets worse.

Is the sugar industry highly subsidized?
Do parasites require a continually high diet of sugar?
More specifically: do parasites rely on aerobic glycolysis?

G @ ncbi.nlm.nih.gov/pmc/articles/PMC3989997/

TRENDS IN PARASITOLOGY ELSEVIER |

$ REE Full-Text Article 7

Trends Parasitol. 2014 Apr; 30(4): 170-175. PMCID: PMC3989997
doi: 10.1016/j.pt.2014.02.001 PMID: 24636355

The proliferating cell hypothesis: a metabolic
framework for Plasmodium growth and
development”

1,2

J. Enrique Salcedo-Sora,1:* Eva Caamano-Gutierrez,
Stephen A. Ward, and Giancarlo А. Biagini'

> Author information + Copyright and License information Disclaimer
This article has been cited by other articles in PMC.

Abstract Go to: Ў

We hypothesise that intraerythrocytic malaria parasite metabolism
is not merely fulfilling the need for ATP generation, but is evolved
to support rapid proliferation, similar to that seen in other rapidly
proliferating cells such as cancer cells. Deregulated glycolytic
activity coupled with impaired mitochondrial metabolism is a
metabolic strategy to generate glycolytic intermediates essential for
rapid biomass generation for schizogony. Further, we discuss the
possibility that Plasmodium metabolism is not only a functional
consequence of the ‘hard-wired’ genome and argue that metabolism
may also have a causal role in triggering the cascade of events that
leads to developmental stage transitions. This hypothesis offers a
framework to rationalise the observations of 20/5 2/49/27
atypical mitochondrial metabolism, and metabolic switching in
nonproliferating stages.

Are parasites incapable of surviving on fats?
Did the sugar industry pay to trick us into thinking that fat was the cause of ill health? LINK

Did this deceptive tactic dramatically reduce fat consumption while also increasing sugar consumption?

If fats protect against parasites and sugars promote them, what effect would removing fats and adding
sugars have on the parasites infecting human hosts?

What is the [real] purpose of sugar subsidies?

It gets worse.

Is promiscuity shamelessly pushed upon society?

Cuckolding can be positive for some|
couples, study says

СЕ)

How I Told Му
Husband and
Boyfriend I'm
Dating Another
Man

1 already had a husband, a
boyfriend, and all the guys I
could fuck. ! had enough guys.
Then there was Conor.

MORE VICE

Isn't Actually’
That Bad

Top Gaining Categories

аќ

Cuckold 472:
Japanese 46
Indian 457
Cosplay 444
Korean 459

Transgender
Creampie
Gangbang
French
Cartoon

Taught One Man

The Couple | Open Relationships | мелік

| xo
Be. e

Ip m

Can parasites be sexually transmitted? LINK1 LINK2

ISN'T ACTUALLY
THAT BAD

DAILY BEAST

со
Ga...

[The case for being a cuck.

Cuckolding: The Sex Fetish
for Intellectuals

Why Being Called a Cuck Is Actually a
Compliment

You should sleep with at
LEAST 25 guys before
settling down, and I'll tell you
exactly why

Cuckold tattoos are the latest trend for
the modern man

@ 006-00:

Why and How I've
Cheated On Every
Person I've Ever Dated

Why I Can't Stop
Cheating

ө The New York Times ©

Opinion: Western men’s sperm
counts are falling, and we ought

to be concerned. The Middle East

can help.

ia 00000

Micro-cheating on my partner
was the best thing ever

How to Keep à
Backup SO in
Case You Get
Dumped

=

Here Is Why A Husband Gives His Wife
Encouragement To Be An Adulteress
% ap

g Ove 567

#Cuckolding is a favorite among relationships.

e vice

He gets so much enjoyment кот my body - my boobs sre huge— but he
cant perform the same way as someone with,

| INST:
We Asked Couples Why They Opened Up Their
Relationship

Man Says Letting His Wife Sleep Around Helped Him.
‘Get’ Feminism

Polyamorous Woman Says The Key To A Successful

The New Yorker @

o=

f adulterer

Marriage Is Having Multiple Partners

Woman goes on dates with

мала and
both na put done work?

Yes, being against cuckoldin
is low-key kinda racist

INSIDE THE WORLD OF CUCKOLDING: A

Se

CUCKOLD EXPLAINS ALL

а=
Mail Online

"It's engrossingly erotic’: Research
shows the number of men who want to
see their partner have sex with others
doubles in a decade

Can an open marriage EVER work?
After 10 years and two children, one
woman reveals what happened when
she told her husband she wanted to
sleep with other men

FEZIZEN Gs

A photographer who took pictures with people she met
on Tinder and pretended to love revealed a lot about
true intimacy

WATCHING YOUR
PARTNER HAVE

CAN BE
GOOD

marie daire SUBSCRIBE FAR-LEFT VOTERS MORE LIKELY TO SHARE
WINGERS MORE

THEIR WIVES, RIGHT
I Cheated on My Boyfriend pea ТУ
with My Rapist
By seducing my assaulter, | was reclaiming the
control I'd lost over my body and identity.

[5

3

re
Nous sommes |

PRÊTS!

I've cheated on every guy I've
ever dated, and | don't feel
even a little bit sorry

Ш pubmed.ncbi.nlm.nih.gov/29211102/

Can sexual transmission support the enzootic cycle
of Trypanosoma cruzi?

Adriano Rios ', Marcelle Ribeiro !, Alessandro Sousa !, Fernando Pimentel ', Luciana Hagström ',
Rafael Andrade 1, Rozeneide М Alves 1, Ana de Cassia Rosa !, Antônio RI Teixeira 1, Nadjar Nitz 1
Mariana M Hecht !

Affiliations + expand
PMID: 29211102 PMCID: PMC5719536 DOI: 10.1590/0074-02760170025
Free PMC article

Abstract

Background: Trypanosoma cruzi circulates in sylvatic habitats, mainly through blood-feeding
triatomines, although other routes also contribute to its dispersion. Sexual transmission of T. cruzi is
an understudied topic, especially among wild mammals. Because of the difficulties inherent to field
work, experimentally infected mice are frequently used to evaluate the transmission of T. cruzi.

Objective: This study aimed to evaluate the sexual transmission of T. cruzi in acutely infected mice.

Methods: Male and female mice in the acute phase of Chagas disease were mated with naive
partners. Then, parasitological tests, mmunohistochemistry, serological assays, and polymerase chain
reaction (PCR) assays were used to detect infection.

Findings: Parasitological analysis showed trypomastigotes in the blood of 2096 of the naive mice after
mating with infected partners. Serological assays detected anti-T. cruzi antibodies in all naive females
mated with infected males and in 6096 of naive males mated with infected females. PCR showed T.
cruzi nDNA bands for all naive mice mated with infected partners. The possibility of sexual
transmission was also confirmed by visualisation of amastigotes in the testes.

Main conclusions: Our results demonstrate that ЭТЕ a ea tr E EE T HT s

that may contribute to maintenance of the parasite's enzootic cycle.

& ncbi.nlm.nih.gov/pmc/articles/PMC582

Evidence for Previously Unidentified Sexual Transmission of Protozoan Parasites
Clara Crespillo-Andujar, ' Marta D az-Menéndez 2 and Marta Mora-Rillo

к Author information + Copyright and License information Disclaimer
Abstract Goto: »
Knowing the mode of transmission of a disease can affect its control and prevention. Here, we identify

5 protozoan parasites with demonstrated presence in seminal fluid, only 1 of which has been identified
as a sexually transmitted disease among humans.

Spaghetti

How many different types of parasites exist?

Helminths, which are large organisms you can see with the naked eye. There are

nearly 50,000 different helminth species including flatworms and roundworms.

Flatworms include flukes and tapeworms. Roundworms include pinworms, which are
the most common helminth intestinal parasite in the United States.

Protozoa, which are one-celled, microscopic organisms. There are over 10,000
different protozoa species. In the United States, the most common ones include
Giardia lamblia, Entamoeba histolytica, Cryptosporidium, and Cyclospora

cayetanensis.

If there are over 60,000 different parasites listed in just two categories, how many more must exist if all kinds
of parasites are considered?

If all of these parasites can be transmitted
between individuals through close, intimate
contact, why are only 18 of them listed on
medical sites as STDs?

Bacterial STDs

Syphilis

Chlamydia
>) Chancroid

» Gonorrhea

Lymphogranuloma venereum
Would increased sexual promiscuity result in
an increase of infected hosts?

Non-gonococcal urethritis

Non-specific genital infection

Viral STDs Historically, what was the purpose of 'You may now kiss the bride’?

Hepatitis B ё betterhealth.vic.gov.au/health/conditionsandtreatments/kissing-and-your-health

HPV Viruses that can be transmitted by kissing

>) Genital warts

Examples of illnesses caused by viruses that can be transmitted during kissing include

Colds - also known as upper respiratory tract infections. Many different viruses can cause the common cold. Colds are thought to be
spread by direct contact with the virus. You could catch the cold from airborne droplets or by direct contact with secretions (fluids and
mucous) from the infected person’s nose and throat

Glandular fever — also known as the kissing disease. Glandular fever is the common term for a viral infection called infectious
Ж mononucleosis, caused by the Epstein-Barr virus. The virus is spread through saliva and infection occurs through contact

ОБ анада Herpes infection — viruses that аге considered рагі of the herpes family include Epstein-Barr, varicella-zoster (causes chickenpox)
and herpes simplex (causes cold sores). Herpes simplex virus can be spread through direct contact with the virus when kissing
Herpes is most easily spread to others when the blisters are forming or have erupted. The virus can be ‘shed’ (spread to others) from
the site of blisters even when they have healed. Chickenpox is easily spread from person to person by direct contact, droplets or
airborne spread

Candidiasis (Moniliasis)

Parasitic

Hepatitis B — kissing may also transmit this virus, although blood has higher levels of this virus than saliva. Infection can occur when
infected blood and saliva come into direct contact with someone else’s bloodstream or mucous membranes. (Mucous membranes
line various body cavities including the mouth and nose.) A person is more likely to be infected when kissing if they have open sores
in or around the mouth

ulosis pubic

Pedic

» Trichomoniasis

Warts - warts in the mouth can be spread through kissing, especially if there are areas of recent trauma

It gets worse.

10

Is plastic rare or everywhere?

Is it now found on top of mountains?
Does it blanket the Artic?

Does it accumulate inside of our bodies?

Microplastics in the Arctic and the
Alps may have blown in on the wind

09000000

ENVIRONMENT

14 August 2019

By New Scientist and Press Association

Do parasites associate well with plastic?

@ nature.com/articles, 22-10485-5
Апісіе | Open Access | Published: 26 April 2022

Association of zoonotic protozoan parasites with
microplastics in seawater and implications for human

and wildlife health

Emma Zhang, Minji Kim, Lezlie Rueda, Chelsea Rochman, Elizabeth VanWormer, James Moore & Karen

Shapiro)

Scientific Reports 12, Article number: 6532 (2022) | Cite this article

5247 Accesses | 1 Citations | 965 Altmetric | Metrics

Abstract

Plastics are widely recognized as a pervasive marine pollutant. Microplastics have been

garnering increasing attention due to reports documenting their ingestion by animals,

including those intended for human consumption. Their accumulation in the marine food

chain may also pose a threat to wildlife that consume species that can accumulate

қ 5 2 В " "NP 1 Micropiastics found in the Alps are carried on the wind and brought to the ground with snow
microplastic particles. Microplastic contamination in marine ecosystems has thus raised Werner L h/Gcet

concerns for both human and wildlife health. Our study addresses an unexplored area of

Tiny particles of plastic have been found in h
parts of Germany and the Arctic, even places as remote as the island of Svalbard and in snow on
drifting ice floes. These microplastics may have drifted there on wind currents.

igh concentrations in snow samples from the Swiss Alps,
research targeting the interaction between plastic and pathogen pollution of coastal waters.

We investigated the association of the zoonotic protozoan parasites Toxoplasma gondii,

Cryptosporidium parvum, and Giardia enterica with polyethylene microbeads and polyester

microfibers. These pathogens were chosen because they have been recognized by the World га! a pnas.or о

Health Organization as underestimated causes of illness from shellfish consumption, and due

to their persistence in the marine environment. We show that 719199
еее in contaminated seawater, with more parasites adhering to

microfiber surfaces as compared with microbeads. Given the global presence of microplastics

© Janice Brahney, © Natalie Mahowald, (9 Marje ...

rs m
in fish and shellfish, this study demonstrates a novel pathway by which anthropogenic See all authors and affiliations

pollutants may be mediating pathogen transmission in the marine environment, with

PNAS April 20, 2021 118 (16) e2020719118;
https://doi.org/10.1073/pnas.2020719118

important ramifications for wildlife and human health.

Edge) environmental Health Perspectives Q

Edited by Akkihebbal R. Ravishankara, Colorado State University,
Fort Collins, CO, and approved February 16, 2021 (received for
review October 8, 2020)

Info & Metrics D PDF

—————-————-———-g--—--—

Microplastics on Human
Kidney Proximal Tubular
Epithelial Cells HK-2 and
Male C57BL/6 Mice

Yung-Li Wang, Yu-Hsuan Lee, Yung-Ho Hsu,

United States of plastic
It's raining plastic:

l-Jen Chiu, Cathy Chia-Yu Huang, Chih-Chia Huang, microscopic fibers fall Significa
Zi-Chun Chia, Chung-Pei Lee, Yuh-Feng Lin, and 5
Мамет ены from the sky in Rocky Microplastic particles and fibers generated

Mountains

Published: 6 Мау 2021
CID: 057003
https://doi.org/10.1289/EHP7612

from the breakdown of mismanaged waste
are now so prevalent that they cycle through

Discovery raises new questions about the
amount of plastic waste permeating the air,
water, and soil virtually everywhere on Earth

the earth in a manner akin to global

B About = Sections * PDF ВА <

biogeochemical cyclesgin modeling the

Abstract show that most atmospheric plastics are
Background: Understanding the epidemic of derived from the legacy production of plastics

chronic kidney disease of uncertain etiology may be from waste that has continued to build up in
critical for health policies and public health А .
responses. Recent studies have shown that the environment. Roads dominated the

micropl св (MPs) contaminate our food chain and p = sources of microplastics to the western
accumulate in the gut, liver, kidney, muscle, and so

on. Humans manufacture many plastics-related : A United States, followed by marine, agriculture,

рго ts. Previous studies have indicated that 2
particles of these products have several effectson | «< It gets worse.

11

and dust emissions generated downwind of

Why is our drinking water fluoridated?
Does fluoride damage the immune system?
What is fluorosis?

Would this increase parasite infection?

& ncbi.nlm.nih.gov/pmc/articles/PMC2956113/

It has been described that application of sodium fluoride (NaF) as the main fluoride source to cells under
culture can induce an excess of p53, a protein expressed when there is damage to the DNA [7]. On the
other hand, induction of apoptosis has been described in the epithelial cells of human lung cultured with

growing amounts of NaF, as well as general changes in alveolar macrophages under culture [8.9].
Additionally, it has been described that incorporation of fluoride in the diet of animals under

experimentation can cause liver damage expressed as induction in the expression of caspases (that are the
last effectors of apoptosis), as well as of the protein bcl-2 (the protein activated during apoptosis) [10,11].

Conversely, it has been reported that in geographic zones where fluorosis 1s endemic, there 1s an increase in
the presence of bacterial, viral, and Parasitic infections in humans or in wild or farm animals that have been
intoxicated with this type of compound when it is present in drinking water in concentrations exceeding the
maximal dose recommended by the World Health Organization (WHO), which is <1 parts per million
(ppm) of NaF [1.2]. In Mexico, acute and chronic fluorosis is present mainly in central-northern states in
which the water presents NaF concentrations that exceed WHO health norms [1]. The presence of NaF in
aquifers is very important because this compound 1s not filtered by the conventional water purification
systems that are employed precisely to prepare water for human consumption [1—6]. Also, NaF dissolved in
water has neither taste nor smell: thus, people can ingest great quantities of this toxin without being aware
of it [1,6]. Once consumed, NaF can cause alterations in systems such as digestive, nervous, reproductive,
and immunological [1.12].

As mentioned previously, individuals who present fluorosis are more susceptible to presenting bacterial,
viral, and parasitic infections, which indicates that there can be a change in their immune system, in which
leukocytes play a very important role as defense systems against these infections [1]. From another
viewpoint, it is known that a in p blood circulation à have completed Тқ =< life

have demonstrated that leukocytes incubated in the presence of NaF | present an increase in the expression
of proteins p53 and bcl-2, which are considered markers of the presence of apoptosis [1,4-8] and which
would indicate that this toxin can promote this type of phenomena in systems іл vivo.

... presence of NaF in aquifers is very important because this compound is not filtered by the conventional
water purification systems that are employed to prepare water for human consumption

.. for human consumption

Flavor»

f e,
..human consumption 4,7. ride (is i

Fluorosis >>> Immunocompromised >>> Hosts more susceptible to parasites

Why do they [really] fluoridate our drinking water?

It gets worse.

12

Why is there such a large push for bug protein and cockroach milk?

[Lvetve|] =

=} MARKETS BUSINESS INVESTING TECH POLITICS CNBC TV INVESTING CLUB @ PRI

Drink up: Cockroach milk is the
protein drink you didn't know
you've been missing

By Susan Sculti, CNN

FOOD & BEVERAGE

How entrepreneurs are persuading
Americans to eat bug protein

PUBLISHED FRI, FEB 14 2020.1:42 PM EST

Jane Wells Fahiemah Al-Ali suas f W in Wa
8JANEWELLS STHISFAHIEMAH

Updated 10:22 AM EDT, Wed July 27, 2016

Will eating edible insects spread parasites?

Q

@ pubmed.ncbi.nim.nih.gov/33108441/

Edible Insects and Toxoplasma gondii: Is It
Something We Need To Be Concerned About?

Maurizio Percipalle 1 2, Antonio Salvaggio 13 Giovanni M Pitari ê, Renato P Giunta 1 5,

1

Alessandra Араго 1, Tiziana Alfonzetti 1, Anna Maria Fausta Marino ! 6

Affiliations + expand
PMID: 33108441 DOI: 10.4315/JFP-20-239

Abstract

Abstract: Novel foods, such as edible insects and food products on the basis of insects, could play an
important role in both human and animal nutrition in the future. The identification of dangers
associated with insect consumption is fundamental to guarantee consumer safety and adequate
regulatory guidelines for operators of the food sector. Although former studies have focused on the
microbiological contamination of fresh or processed edible insects, so far little information is available
about the occurrence of foodborne parasites, such as Toxoplasma gondii, whose life cycles make them
candidates for potential insect breeding substrate contamination. Hence, we investigated the
presence of contaminating T. gondii in farmed edible insects to rule out this further hazard for

consumers. Four species of insects most commonly used as food for human consumption were
analyzed: mealworm; African migratory locust, house cricket, and silkworm. Samples included live
specimens but also minimally (dehydrated) and highly processed edible insects.
рМА ууеге детестеді іп ватріе5 оҒ 4деһуагағейі теаімогпт These results highlight the need for
implementing good farming and processing practices with particular care paid to safe storage and
handling of feed and substrates used for edible insects to reduce the chance of T. gondii entering the
human food chain.

Пп ё pubmed.ncbi.nim.nih.gov/31283777/

A parasitological evaluation of edible insects and
their role in the transmission of parasitic diseases to
humans and animals

their parts. One of the most commonly used species of insects are: mealworms (Tenebrio molitor),
house crickets (Acheta domesticus), cockroaches (Blattodea) and migratory locusts (Locusta migrans).

What is the [real] reason why they want to
use insects as a food source?

In this context, the unfathomable issue is the role of edible insects in transmitting parasitic diseases

that can cause significant losses in their breeding and may pose a threat to humans and animals. The

aim of this study was to identify and evaluate the developmental forms of parasites colonizing edible

insects in household farms and pet stores in Central Europe and to determine the potential risk of

parasitic infections for humans and animals. The experimental material comprised samples of live

insects (imagines) from 300 household farms and pet stores, including 75 mealworm farms, 75 house

cricket farms, 75 Madagascar hissing cockroach farms and 75 migrating locust farms. Parasites were
detected in 244 (81.33%) out of 300 (100%) examined insect farms. In 206 (68.67%) of the cases, the
identified parasites were pathogenic for insects only; in 106 (35.33%) cases, parasites were potentially

parasitic for animals; апа іп 91 (30.3326) Cases, parasites were potentially pathogenic for humans§

13

It gets worse.

What is the purpose of vaccines?
Are excipients, such as polysorbate-80 placed into vaccines?

& sciencedirect.com/science/article/pii/0378517389902664

International Journal of Pharmaceutics
Volume 57, Issue 1, 15 December 1989, Pages 77-83

ELSEVIER

The effect of polysorbate 80 on brain uptake and
analgesic effect of D-kyotorphin

Toshiyasu Sakane *, Chihiro Tanaka :, Akira Yamamoto +, Mitsuru Hashida >, Hitoshi Sezaki 2,1, Hiroshi Ueda 2,
Hiroshi Takagi?

Show more v

https://doi.org/10.1016/0378-5173(89)90266-4 Get rights and content

Abstract

The effect of the non-ionic surfactant, polysorbate 80, on the blood-brain barrier
was investigated by using an in situ brain perfusion technique. It was confirmed
that the brain perfusion technique allowed quantitative measurement of the
cerebrovascular transport of drugs with varying degrees of lipophilicity and D-
glucose. A linear relation was obtained between cerebrovascular PA products of
drugs and their octanol/water partition coefficients. Transport of D-glucose, which
is known to be a carrier-mediated process, was observed to be concentration-
dependent and the Ky, Vmax and Қа values could be obtained by non-lineara least-
squares regression. It was shown in perfusion experiments that the intravascular
volume calculated from [**C]inulin was increased significantly by intravenous
administration of polysorbate 80. The content of D-kyotorphin also showed a
tendency to increase. These effects of polysorbate 80 were also confirmed by the
analgesic effect of D-kyotorphin in mice in vivo. D-Kyotorphin at 300 mg/kg
showed no analgesic activity whereas it did display a significant level following
administration with polysorbate 80. These results suggested that polysorbate 80

@ nature.com/articles/srep31578
affected the blood-brain barrier and enhanced the brain uptake and analgesic

activity of D-kyotorphin. Abstract

adjuvants remain the most widely used and effective

adjuvants in vaccination and immunotherapy. Herein, the particle size

Are adjuvants, such as aluminum, placed into vaccines?

distribution (PSD) of aluminium oxyhydroxide and aluminium

hydroxyphosphate adjuvants was elucidated in attempt to correlate

these properties with the biological responses observed post

By temporarily distracting the immune system with the vaccination. Heightened solubility and potentially the generation of Al*
adjuvant, is the immune system less capable of reacting
to other threats?

What is reactogenicity?

Could this cause a rapid increase in parasitic infection?

in the lysosomal environment were positively correlated with an

increase in cell mortality in vitro, potentially generating a greater

inflammatory response at the site of simulated injection. The cellular

uptake of aluminium based adjuvants (ABAs) used in clinically approved

vaccinations are compared to a commonly used experimental ABA, in an

in vitro THP-1 cell model. Using lumogallion as a direct-fluorescent

molecular probe for aluminium, complemented with transmission

Do these excipients and adjuvants help intra-bodily ob-
jects cross the blood-brain barrier?

electron microscopy provides further insight into the morphology of

internalised particulates, driven by the physicochemical variations of

the ABAs investigated. We demonstrate that not all aluminium adjuvants

are equal neither in terms of their physical properties nor their

Are parasites intra-bodily objects?

biological reactivity and potential toxicities both at the injection site

and beyond. High loading of aluminium oxyhydroxide in the cytoplasm

of THP-1 cells without immediate cytotoxicity might predispose this

form of aluminium adjuvant to its subsequent transport throughout the

body including access to the brain.

Are adjuvants and excipients placed into vaccines to
help parasites gain access to human brains?

14

Are parasites an infectious disease? Diseases Declined 90%

To prevent disease, should we focus on more BEFORE Vaccines Were introduced
injections or on access to clean water? Mane *
i Due to Sanitation and Clean Water Systems

Whooping Cough / Pertussis Diphtheria

3 А А Vaccine
Historically, which was more successful?

Death Rate

88885884858

Measles Scarlet Fever

Death Rate
882888588

8882883858
© Kolten Parker ©
Mi GkolenParker [ v Fonon | Typhoid Fever
Black water coming out of taps in Crystal City as 5 city officials

are under fed indictment mysanantonio.com/news/local/art...
1:27 PM - 19 Feb 2016

-
[3

No widespread Vaccine

vaccination

Death Rate
Death Rate
"usus

о „5

@ theguardian.com/environment/2016/jan/16/flints-water-crisis-what-went-wrong

Flint's water crisis: what went wrong

If clean water is so effective at preventing
disease, then reconcile the following:

After the water supply was found to contain high levels of lead,
evidence is mounting that officials ignored or neglected indicators
1. Amount of money spent on water ofa growing crisis

treatment facilities
2. Amount of money spent on develop-
ing patentable vaccines

What is the [real] purpose of vaccines?

It gets worse.

Lee and Ernie Perez knew something was amiss when their three cats started
throwing up after drinking water.

What are heavy metals?
Do parasites associate well with heavy metals?

Is aluminum a heavy metal?

Is aluminum sprayed over major metropolitan areas to "prevent global warming by reflecting sunlight"?

Is cadmium a heavy metal?

Did the US government admit to spraying ZnCdS over 29 urban and rural areas in the US and Canada? LINK

Do these heavy metal particles eventually fall to earth where they enter the body through respiration?

What other ways might heavy metals, like aluminum, enter the body?
Is there a way for heavy metals to bypass the body's natural filtration system?

Aluminum in vaccines

Aluminum is used in vaccines as an adjuvant. An adjuvant is vaccine component that boosts
the immune response to the vaccine. Adjuvants allow for lesser quantities of the vaccine and

fewer doses. The adjuvant effects of aluminum were discovered in 1926. Aluminum

adjuvants are used in vaccines such as hepatitis A, hepatitis B, diphtheria-tetanus-containing

vaccines, Haemophilus influenzae type b, and pneumococcal vaccines, but they are not used

in the live, viral vaccines, such as measles, mumps, rubella, varicella and rotavirus.

Previous studies have linked frequent exposure to high levels of aluminum to
adverse health effects on the central or peripheral nervous system or
both), Alzheimer's disease, and breast cancer. Jan 15, 2020

www.medicalnewstoday.com » articles

How can we reduce our exposure to potentially harmful ... Eye Worm

Nose Worm

е с @ cell.com/parasitology/comments/S0169-4758(98)01358-1
Are dormant parasites activated

by the presence of heavy metals? о Trends in Parasitology

REVIEWS ME 15, ISSUE 1, P16 ANUAR
Parasites as Accumulation Indicators of Heavy Metal Pollution

В. Sures • К. Siddall « H. Taraschewski e B. Sures R. Siddall > H. Taraschewski

DOI: https-//doi.org/10.1016/50169-4758(98)01358-1

~ PlumX Metrics

What is the [real] reason for Abstract
putting heavy metals into our

ў Parasites are attracting increasing interest from parasite ecologists as potential
bodies?

indicators of environmental quality because of the variety of ways in which they respond
to anthropogenic pollution. However, until recently, little was known about the
accumulation of toxins within parasites. Certain parasites, particularly intestinal
acanthocephalans and cestodes of fish, can accumulate heavy metals at concentrations
that are orders of magnitude higher than those in the host tissues or the environment. In
this review, Bernd Sures, Roy Siddall and Horst Taraschewski discuss the recently

It gets worse. described phenomenon of conspicuous metal accumulation by parasites and how this
might be applied to environmental monitoring. They also suggest how environmental
science and parasitology might profit from each other in the near future.

In contrast, does Fenbendazole eliminate parasites without side-effects?
15 Fenbendazole successful in removing parasites from any mammal?
Can it even successfully remove parasites from non-mammals, such as reptiles and fish?

ШЕ ecommons.luc.edu/cgi/viewcontent.cgi?article=4366&context=luc_theses

1985

Survey of Intestinal Parasites in Zoo Populations of Two Central
Illinois Zoos and Study of Current Anti-Parasitic Drugs and
Prophylactic Techniques

Verona A. Barr
Loyola University Chicago

Fenbendazole has also been tested on reptiles. Holt

and Lawrence (1982) used fenbendazole in the treatment of
82 reptiles. They found fenbendazole to be effective
against single and mixed infections of ascarids, oxyurids
and strongyloides in 84.1% of the reptiles treated. А11
of the snakes were given a single dose while the tortoises
were given two doses separated by a three week interval.
No deaths or side effects were observed in the test group.
In general, the literature has shown that fenbendazole is

apparently free of side effects.

H
N
NHCOOCH,

All without side effects.

15 Fenbendazole safe for use in humans? LINK

EUROPEAN MEDICINES AGENCY

SCIENCE MEDICINES HEALTH

15 January 2014
EMA/42178/2014
Veterinary Medicines Division

Committee for Medicinal Products for Veterinary Use (CVMP)

CVMP assessment report for Panacur AquaSol
(EMEA/V/C/002008/X/0003)

International non-proprietary name: fenbendazole

Assessment report as adopted by the CVMP with all information of a
commercially confidential nature deleted.

Toxicological studies

Single dose toxicity

Oral single dose studies in mice, rats, rabbits and dogs demonstrate that fenbendazole is of low acute
toxicity. The study results did not allow the derivation of no-observed-adverse-effect levels (NOAELs).

Repeat dose toxicity

Data on repeat dose toxicity are available from rats and dogs. The overall NOAEL was 4 mg/kg
bw/day, based on lymphoid hyperplasia observed in dogs.

Tolerance in the target species of animal

Please refer to Part 4. No points of concern relevant for the safety of fenbendazole in humans could be
identified.

18

If Fenbendazole has no side effects and is safe for human consumption, why was an extensive study funded
to determine how long ‘animals used for human consumption’ must be weaned off of Fenbendazole in order
to ensure the removal of Fenbendazole from the animal before slaughter?

EUROPEAN MEDICINES AGENCY

SCIENCE MEDICINES HEALTH

15 January 2014
EMA/42178/2014
Veterinary Medicines Division

Committee for Medicinal Products for Veterinary Use (CVMP)

CVMP assessment report for Panacur AquaSol
(EMEA/V/C/002008/X/0003)

International non-proprietary name: fenbendazole

Assessment report as adopted by the CVMP with all information of a
commercially confidential nature deleted.

Withdrawal periods

Based on the provided residue depletion study in tissues a Withdrawal period of 6 days for edible)

tissues can be established for Panacur AquaSol 200 mg/ml oral suspension for use in drinking water for
chicken when administered at the maximum recommended dose of 1 mg fenbendazole/kg bw/day for
5 consecutive days.

The withdrawal period for slaughter is calculated using the alternative approach by taking the first time
point where all concentrations are below the respective MRL (72 hours for liver, 96 hours for muscle
and 120 hours for kidney and skin+fat) and adding a safety span of 20%, resulting in a withdrawal
period of 4 days for liver, 5 days for muscle and 6 days for kidney and skin+fat. Overall withdrawal
period for slaughter: 6 days.

Based on the provided residue depletion study in eggs a withdrawal period of zero days for eggs can
be established for Panacur AquaSol 200 mg/ml oral suspension for use in drinking water for chicken
when administered at the maximum recommended dose of 1 mg fenbendazole/kg bw/day for 5
consecutive days.

As at all-time points residue levels were below MRL (though above LOQ), the withdrawal period is
calculated by estimating the 95% tolerance limit for each time point (safe concentration per milking
(SCPM) method for milk). The 9596 tolerance limits for all time points were below MRL. Withdrawal
period for eggs: zero days.

19

Ivermectin Equine Wormer
is only approved by the FDA
for use in horses only.
This product is NOT approved
for human consumption.

Compare this treatment of Fenbendazole to the treatment of Glyphosate.

Does Glyphosate cause terrible damage to the cells inside the human
digestive tract?

Does this ‘damaged human digestive tract’ result in the digestive tract
inefficiently absorbing vitamins and minerals required for a strong
immune system?

Is Glyphosate sprayed directly onto crops used for human consumption?
Is Glyphosate sprayed onto crops immediately before harvest, resulting in
Glyphosate absorbing into food meant for human consumption?

Would spraying Glyphosate onto ‘food meant for human consumption’
compromise the immune system of any human who ate that food?

Does compromising the human immune system benefit parasites inside
human hosts? LINK

Compare and contrast:

Fenbendazole harms parasites inside humans.

Glyphosate helps parasites inside humans.

Fenbendazole is illegal in food meant for human consumption.
Glyphosate is legally authorized in food meant for human consumption.

Reconcile.

It gets worse.

20

If Fenbendazole has no side effects and is safe for
human consumption, why is Fenbendazole labeled
‘not for human consumption’?

If Fenbendazole has no side effects and is safe
for human consumption, why require that

Fenbendazole not be used in animals meant for
human consumption?

“For other areas in the world,
retreatment periods for the
migrating larvae of S. vulgaris
may be different; consult with
your veterinarian.

CAUTIONS: Keep this and all
medication out of the reach of
children.

When using Panacur® (fenben-
dazole) Paste 10% concomi-
tantly with trichlorfon, refer to the
manufacturer’s labels for use and
cautions for trichlorfon.

DOSAGE:

Panacur® (fenbendazole) Paste
10% is administered orally at a
rate of 2.3 mg/Ib (5 mg/kg) for the
control of large strongyles, small
strongyles, and pinworms. One
syringe will deworm a 1,100 Ib
horse. For foals and weanlings
(less than 18 months of age)
where ascarids are a common
problem, the recommended dose
is 4.6 mg/b (10 mg/kg); one
syringe will deworm a

550 Ib horse.

Let us review:

Fact: Despite there existing a recommended parasite schedule for every other species which comes into
direct contact with humans, there exists no recommended parasite treatment schedules for humans.

Fact: It has been made illegal to treat humans with the most effective methods for treating parasites.

Fact: All parasite medications are intentionally prevented from entering food meant for human consumption.

All of this results in a system where humans are forced to rely entirely upon their immune system to combat
parasites. However...

Fact: Humans have a naturally weak immune system due to their inability to produce Vitamin C.

Fact: The human immune system has been intentionally weakened through a variety of external methods:
1. Fluoride added to our water
2. Heavy Metals added to our air
3. Glyphosate added to our food
4. Adjuvants added to our vaccines
5. Alcohol pushed in mainstream media
6. Microplastics added to environment

Fact: The spread of parasites is intentionally encouraged in variety of ways:
1. Sugars added to our food
2. Infected insects used as food
3. Addictive psychiatric drugs prescribed by doctors
4. Promiscuity pushed in mainstream media
5. Fenbendazole removed from our food

X9,000 — 2um

Healthy Immune Function

Taken together, these things turn the human body into the perfect parasite-breeding ground. Due to lifestyle
choices, environmental factors and genetic factors, humans are systemically much more susceptible to
parasitic infection than any other mammal.

So why do all other mammals have recommended parasite-treatment schedules and humans do not?

Logical thinking.

The answer is worse than you can imagine.
21

2. THE BRAIN

Why do parasites need access to human brains?

@ INDEPENDENT

SPORT

Can the parasite gain control over the
host by accessing the central nervous

system? "Lombie' deer disease could spread to humans, experts
warn

NEWS POUTICS VOICES CULTURE INOY UFE INDYBEST voto DAILY EDITION

‘It’s possible the number of human cases will be substantial and will not be isolated events’

@JournoJane | Monday 18 February

Can parasites lobotomize their host and
turn them into living zombies?

People who eat deer meat could be at risk of contracting a deadly

infectious disease that is spreading across the animals’ US populations,

experts have warned.

LINK

Chronic wasting disease (CWD) -dubbed “zombie” deer disease - has
infected deer. elk and moose across 24 American states and two Canadian

provinces.

The disease attacks tissues including the brain} and spinal cord, causing
dramatic weight loss, loss of coordination, listlessness, drooling, excessive

@ sciencedaily.com/releases/2019

Science News thirst or urination and intense aggression before the animal dies.

‘Flying salt shakers of death:' Fungal-infected 'zombie'
cicadas

June 25, 2019

& theconversation.com/the-crab-castrating-parasite-that-zombifies-its-prey-27200
The crab-castrating parasite that zombifies
its prey

West Virginia University

West Virginia University researchers have discovered that a cicada
fungus called Massopora contains chemicals similar to those

found in hallucinogenic mushrooms = : ex THA "m

9 Meet Sacculina carcini - а barnacle that makes a living as a real-life body-snatcher
The fungus causes cicadas to lose their limbs and eccentric be- of crabs. Unlike most barnacles that are happy to simply stick themselves to a rock
havior sets in: Males try to mate with everything they encounter. al- and filter food from the water, Sacculina and its kin have evolved to be parasitic,

and they are horrifyingly good at it.

though the fungus has consumed their genitals and butts.

Despite the horrid physical state of infected cicadas, they continue The microscopic larva of Sacculina seeks out an unsuspecting crab using
to roam around freely as if nothing's wrong, dousing other cicadas

with a dose of their disease

specialised sensory organs. It then settles on a part of the crab where its armours
is most vulnerable, usually on the membrane at the base of one of the crab’s hair

А (called a setae).
You've heard of "The Walking Dead." This is "The Flying Dead."

"They are only zombies in the sense that ШЕПТЕ Кеете Eod

said Matt Kasson, assistant professor of forest
pathology and one of the study's authors

The larvae then transforms itself into a kind of living hypodermic syringe (called
a kentrogon). This syringe stabs the base of the crab's hair and injects the next
stage of the parasite - a microscopic blob called the vermigon - into the crab's

bloodstream. This blob will eventually grow into a parasite та 1107591175

rab's entire body.
Why lobotomize the host? Sacculina (аке оует (һе һові іп Бойһ Боду апа тіпа it castrates the crab, then

turns it into a doting babysitter that grooms and aerates the barnacle’s brood,
tending the next generation of baby-snatchers as if they were its own babies. Lest

Does the lobotomy allow pa rasites to force you think Sacculina is alone in its nightmarish ways, it is just one genus in an
the host to spread the infection to new entire order of barnacles called Rhizocephala (the “root head”).
hosts?

In estuaries around the world, tiny trematode worms take over the bodies of aquatic snails. These parasitic flatworms invade the

snails’ bodies and use them to support the worm colony, sometimes for more than a decade, "CYW. ТЕТТЕ "
according to Ryan Hechinger, a scientist at California's Scripps Institution of Oceanography

22

What happens when parasites enter the brain of a human host?
Can the brain be damaged to influence human behavior?

Can the brain be damaged to limit human cognitive abilities?
What are NPCs?

NPC

Do humans have a second brain?

What is the Enteric nervous system? LINK

Where are parasites most commonly found?

Can parasites residing in the gut influence behavior?
What are ‘Gut Instincts’?

What is the subconscious?

Can the subconscious be manipulated?

Can parasites manipulate the subconscious to change human personality?

@ newscientist.com/gallery/mg20327161300-enemy-within-human-parasites

mper NewScientist

News Podcasts Video Technology Space Physics Health More » Shop Tours Events Jo

The enemy within: 10 human
parasites Why influence host personality?
60000 Why influence host behavior?

9 July 2009

Symbiotic relationships between a parasite and a host can have beneficial еНесе even changing |
тт енна and evolution. Often, however, the damage outweighs the positives. New Scientist
investigates some of the most common human parasites and the damaging effects they can have

The end goal of a parasite is not to kill the host,
but to spread more parasites to more hosts.

It gets worse.

Reminder: Are parasites sexually transmitted?
Reminder: Can parasites change the host’s personality?
Why might the following behavior seem so prevalent?

| just finished up living with a guy that was cheating on his girlfriend and he thought it was funny. Also
expected me to share in the laugh. | could write several volumes on that cocksucking demon.

H]
| know the type all too well.

It's like meeting Agent Smith. They are all the same personality. Sick and twisted but in exactly the
same way. Dumb as all shit too. Unable to create anything new. They have no original thoughts.

2118 ! Г How many people did you sleep with in college?

40 comments share save hide report crosspost

j by: best w

RainbowCrocs

Let's see. 3 a week. 50 weeks in a year. 200 weeks in 4 years. So around 600.

permalink embed save give award

NU

2 UnnamedNamesake

Never kept count. But over 200.

permalink embed save give award

9 kimininegaiwo

I would never tell my boyfriend this, but more than 100. А А А

болтын ombud өне чаны The infected engage іп promiscuous
ons behavior to spread the parasite.

I wrote down all their names in a spreadsheet. And the magic number is.....ding, ding, ding...

permalink embed save give award

of Venne1139 ' The infected create a promiscuous
I was the Pi Kappa Alpha Dream Girl so a lot of frat guys. Probably around 100. society to spread the pa rasite

permalink embed save give award

tessanicoleS
50 FIV. If you include giving oral then more than 400,

permalink embed save give award

Hollywood told us we would fight man-eating
zombies during the apocalypse.

But it is something much more subtle, much
more alluring, and far, far more frightening:

They are sex zombies.

24

Why does every major civilization collapse when it allows promiscuity?
Do parasites use sexual promiscuity to turn citizens into zombies?
Do the infected sex zombies then tear down their own civilization?

If you want to destroy any nation
without war, make adultery or nudity

British ethnologist and social anthropologist at Oxford
Mai and Cambridge University, Joseph Daniel

Unwin MC (1895 - 1936) conducted a massive study of 6 major
civilizations and 80 lesser societies covering 5.000 years of history. He
set out his study expecting to find evidence supporting Sigmund
Freud's theory that civilizations are essentially neurotic and coe
themselves by restricting sex too much. But to Unwin's surprise, a
the evidence he discovered pointed exactly to opposite conclusions.

common in the young generation.

Saladin
чү

- жі

In his exhaustive examination of sexual behavior and their

affect upon society, Unwin observed that monogamous : ; А
cultures prosper and those disinclined to restrain.sex to What is the Bacchanalian Conspiracy?

monogamous marriage remain primitive or, if once Did it lead to extreme Roman degeneracy?

successful, they decline. Did women rule over it?
әлігі Unw in Wor Why did it involve violence and sodomy?

T and Culture Seanad Охо University Press, 1934); Why did homosexuality become the norm?
Sexual Regulations and Cultural Behavior (London: Oxford University Press, 1935) A э

Hopousia: Or the Sexual and Economic Foundations of a New Society (London: Why did Rome [really] collapse:
George Allen and Unwin, 1940).

“Under cover of religion, priests and acolytes broke civil, moral and religious laws with impunity.
Young girls and youths were seduced, and all modesty was set aside. Every kind of vice found its
full satisfaction. But crimes did not remain confined to these meetings. False witnesses, forgeries,
false wills and denunciations proceeded from this focus of crime. Poisoning and assassination
were carried on under the cover of the Bacchanalians.”

Does any of this sound familiar?

"Unwin's conclusions, which are based upon ап
enormous wealth of carefully sifted evidence, тау be summed
up as follows. All human societies are in one or another of six
cultural conditions: zoistic, manistic, deistic, rationalistic,
expansive, productive. Of these societies the zoistic displays
the least amount of mental and social energy, the productive
the most. Investigation shows that the societies
exhibiting the least amount of energy are those
where pre-nuptial continence is not imposed and
where the opportunities for sexual indulgence after.

marriage are greatest. The cultural condition of-a
society rises in exact proportion as it imposes рге:
nuptial and post-nuptial restraints upon sexual
opportunity.”

It gets worse.
25

3. SYMPTOMS

Tami

А : ЕР
Are you infected with parasites: July 15, 2016 at 9:30 PM

How would you know?
Should you get tested?

Is testing even effective? LINK NK Thad 4 stool tests to date, one by the lab my Doctor ordered at the lab he uses and 3 from
me going to emergency rooms. All tests with negative results. But my stool samples were
full of parasites as they are every bowel movement and very visible. I have had them for
no less than 5 years. I feel like I’m fighting for my life and the Doctors are letting me die
by ignoring what is so obvious to see. I have taken in bottles of my stool watered down
with living, moving parasites at the bottom of the bottle, certain that i could finally
convince someone to do something to get rid of them before they kill me. I have
recognized no less than 5 different parasites by breaking down my stool in water until I
can see the parasites. jinga uo can see them and still will not prescribe medication

Бесаиѕе е 1а геѕиїёѕ соте Баск перануе There's something wrong with that picture,

Anonymous (ID: 6527270) = 08/26/22(Fri)23:17:45 No.392742108 » >>392742262

22392740841

The doctor likely had zero education on parasites. Life cycles, vectors etc.

22392741217

| unintentionally fasted when | got very sick with ? for 3 weeks and couldn't hold anything down. They migrated out of my alimentary system. | explained it up thread.

| went to a ENT. It got very ugly between us. She accused me of DL images from Internet. VERY expensive bullshittery. My breast cancer friend | spoke about was telling her
neighbor about my nose worms. The neighbor thinks--hey maybe that's what's wrong with me. So buys one of those pump type neti pots. First go sucks out a mess of worms,
Panics, rushes with container to doctor...who refused to send them to the lab, and gave her 1 pill.

Try getting a fecal float test from a doctor. One lady dropped a LIVE one on top of her 'sample" and the test results came back NOPE--you don't have parasites. She
documented it all with pics. Including the live one on top of her "sample".

Dr. Klinghardt discusses parasite detection:

Unfortunately, there are no reliable lab tests to rule out parasites, especially those that stray from the
gut into the central nervous system.

Insiders estimate the detection rate to be less than 196. So out of a hundred people who һауе
parasites, [lab tests will show a positive result] in one.

Every parasitologist knows this, but they are not allowed to talk about it. As a clinician | have to say,
there are way more people being made ill by parasites than the lab work can show right now. [3]

signs of
parasites

Important Video: LINK

anxiety /

brain fog/
depression

weak memory

How ever, to have parasites, it c
etc
And boom, y

stomach : :
infections
problems Instead of looking for a root problem on diseases

adhd, and have to dea h the medicines side е
Look for parasites in you, it might be the root problem to your depression, over eating, mental fogginess. Etc

| was raised in MX, so this is a commonly recommended tion on families

dark circles

under eyes иш

ssues

headache

They actually have a ton of commercials about it
The Red Cross used to administer dewormers at the sc

problems

THEY KNOW--my mom told me that when they were growing up they were lined up in the garage once a month and treated with kerosene or turpentine (both are or were pure
pine oils) then given a hefty dose of castor oil.

They were no more dirty etc than modern life is, in fact likely cleaner. They wouldn't allow dogs/cats in the house
7doggo goes out for morning shit, sniffs around yard, rolls in raccoon shit or sniffs, eats it
>runs back in house jumps in bed with baby and licks it's face

Raccoons carry FLUKES, fluke eggs stick to fur, rover licks fur, your face, and sprinkles the parasite by products..everywhere

| watched on "van life couple" take their cat to the vet when it shat out parasites on their bed. | was like..what about you? What about baby? What about---nope--just the cat got
treated.

26

Are you infected?
Does your poo float?
Do you have body odor?

Common food sources of
parasite infection: LINK

Do you get headaches? Anonymous (ID: ERZI) L+] 04/06/22(Wed) 11:48:18 No.371469040 »

Do you have addictions? >>371455554

| was addicted to weed and coca cola, magically stopped being addicted after doing a deworming
procedure similar to yours. And my shit stopped floating, would just sink to the bottom of the toilet.

>>371458800

I've been pretty clear minded since, just take probiotics ог eat something that will replenish the biome.

Q ё pubmed.ncbinlm.nih.gov/1730397 Not that hard.

> Am J Ther. 2007 Jan-Feb;14(1):63-105. doi: 10.1097/01.mjt.0000208 272.42379

Recurrent headache as the main symptom of
acquired cerebral toxoplasmosis in nonhuman
immunodeficiency virus-infected subjects with no
lymphadenopathy: the parasite may be responsible
for the neurogenic inflammation postulated as а
cause of different types of headaches

Joseph Prandota !

Affiliations + expand
PMID: 17303977 DOI: 10.1097/01.mjt.0000208272.42379.aa

Abstract

Headache and/or migraine, a common problem in pediatrics and internal medicine, affect about 5%
to 10% children and adolescents, and nearly 30% of middle-aged women. ШЕСІ P P 03

most common clinical manifestations of acquired Toxoplasma gondii infectiong 4 ие

system (CNS) in immunosuppressed subjects.

Common Symptoms of Parasites in Humans

i Constipation.
Gas or bloating.
Diarrhea.

Pains or aches in the back, joints or muscles.
Irritable bowel syndrome.
Allergies.

Increased appetite.

Itchy ears, nose or anus.
Nervousness or grumpiness.
Chronic fatigue, lethargy or apathy.
Various skin problems.
Tooth grinding or clenching.
Anemia.

Excess weight.

Forgetfulness. =
Vision problems. zs
Problems sleeping.

Do you have allergies? LINK

Do you has asthma? LINK

Do you have diabetes? LINK

Did you answer 'yes' to any of these questions?

27

Do you eat fruits or vegetables?

Do you eat meat?

Do you drink tap water?

Do you shower with tap water?

Have you ever used a public restroom?

Do you pick your nose?

Have you ever had a cold?

Have you had more than one sex-partner?
Has your sex-partner been with anyone else?
Are your pets allowed inside the house?

Your pets

Or do you have no symptoms at all?

"You can have a person riddled with infection who
never realized there's a 2-centimeter-long worm in
their eye and thousands of parasites in their blood,”
Dillman said. "The immune system never signaled
something was wrong. How is that possible? We know

very little about how that works.”

Dillman is focused specifically on the proteins that
nematode spit releases into hosts during an

infection.

"Venom also describes this accurately,’ Dillman said.

& naturalnursemomma
@naturalnursemom

The CDC says that only 14% of the US
population has been exposed to
parasites. But that isn't anywhere
near the reality of it. Conventional
medicine all but ignores them
because most tests do not pick them
up.

Increasing food allergies, anxiety,
insomnia are all linked to 2 ©.

Parasites are arguably the most
common cause of health issues
today. The amount of symptoms
caused by them are endless as they
impact structural, chemical, and
emotional functions. This is a reason
why they are ignored by medicine,
most believe a digestive symptom
must be present

However, on top of GI symptoms,
parasites are linked to teeth grinding,
insomnia, anxiety, depression,
seizures, skin issues, allergies,
fatigue, chronic pain, anemia, itchy
butt, add/adhd, bed wetting and night
terrors to name a few.

Science News from research organizations

Memory, Depression, Insomnia -
- And Worms?

: August 5, 2008
Oklahoma Medical Research Foundation

Researchers have spent decades probing
the causes of depression, schizophrenia
and insomnia in humans. But a new study
may have uncovered key insights into the
origins of these and other conditions by
examining a most unlikely research sub-

Research article | Open Access |

Associations of mental
disorders and neurotropic
parasitic diseases: a meta-
analysis in developing and
emerging countries

Labanté Outcha Daré ©, Pierre-Emile Bruand,
..Pierre-Marie Preux + Show authors

BMC Public Health 19, Article number: 1645
(2019) | Cite this article

1.Parasites contribute to fatigue by
feeding on iron. They steal your iron
stores causing clinical or subclinical
anemia which equates to low
oxygenation of your tissues. This
manifests as fatigue.

2.Parasites contain many serotonin
receptors. This means they also steal
your serotonin which is the hormone
that when low relates to anxiety/
depression & insomnia. This is also
why symptoms near the full moon are
often due to parasites because
serotonin levels are increased.

3.Parasites also shift the immune
system into a TH2 pattern which
elevates IgE and mast cells in the
body. This equates to allergies of all
kinds including food and
environmental. Skin issues like hives
and rashes also result from this TH2
shift.

| The role of parasites and

pathogens in influencing
generalised anxiety and
predation-related fear in the
mammalian central nervous
system

Maya Kaushik et al. Horm Behav. 2012 Aug.

(Intestinal parasites and lactose
malabsorption]
[Article in French]

D Gendrel et al. Arch Fr Pediatr. 1990 Oct.

Show details x

Abstract

Breath-test was performed for diagnosis of lactose
malabsorption in 50 Gabonese children of normal
nutritional status, aged 5 to 15 years, with parasites
in stools, but without diarrhoea or digestive
symptoms. Control group was unparasitized and

28

naturalnursemomma Here's the thing
about this issue... you go to your
regular provider and they say okay
let's run a stool test. It's called an ova
and parasite (O&P) ... but it's negative
every time. At the very least, they
need to repeat x3. BUT testing for
parasites is elusive... and what is
worse? Testing for Lyme, mold can be
elusive too.. these things like to hide
in parasites. As well, with a chronic gut
infection from parasites you will also
have immune suppression increasing
the likelihood of constant sickness.

Symptoms of parasites might look like
the things mentioned in the slides, but
it also might look like weight loss
resistance or a lot of weight loss,
allergies, fatigue, micronutrient
deficiencies, rashes, inflammation,
autoimmune activation. It might look
like insomnia in children, frequent leg
cramps, increasing food sensitivities,
hyperactivity or mood changes...See
that's the thing, as @drcharliedc_2.0
was saying, parasites cause symptoms
in every single body system.

We WILL be discussing solutions... first
steps should always be opening
drainage pathways. Making sure
having daily && @. sweating,
sunshine, deep breathing, etc. more
on this to come.

One more crucial aspect of parasites
is their ability to protect and harbor in
toxins like Lyme, EBV and mold. If you
are detoxing from any of those and
not taking into consideration
parasites, you may be playing a tug of
war battle with them which can make
it impossible to heal.

Rope Worms:
LINK1
LINK2
VIDEO

CHAPTER III
Tue VALUE or А Lire

Tuere is a certain class of people in the South known

as "poor whites," noted for their shiftlessness and
indolence. These are all native-born
Americans. Many of their ancestors
were of Anglo-Saxon stock, which has
been called “the flower of the race.”
Why have they degenerated into this
condition of indolence, shiftlessness, and
poverty?

A few years ago the cause was dis-

blood of its victim. It takes away from a person all
desire and ability to work and makes him “ feel tired all
the time.” 3

Besides afflicting two million people with a dreadful

chronic disease and slaughtering thousands of children,
this tiny parasite has, it is estimated, cost the South
several hundred million dollars by retarding the devel-
opment of agriculture and industry.

And yet, amazing as the statement may seem, every
victim of hookworm disease may be completely cured
at a cost of only sixty cents each, and the disease may
be entirely prevented by the most simple precautions.

Some one has put it in this way: “If you owned a

machine that ought to earn $300 a year and it was

covered, and it was found to be chiefly
a matter of ill health. A tiny One cause
parasite, less than half an inch of shift
long and no thicker than a piece '***"***
of sewing thread, was the cause of all
the trouble. This little Aookworm has

earning only $100 and you could restore the proper
earning power by an expenditure of sixty cents, could
there be a better investment for your money ?”

A sixteen-year old boy was so weakened by hook-
worm disease that he was scarcely able to do two days
work a weck. He was treated, and the hookworms
expelled from his body. During the next five weeks he
gained seventeen and a half pounds in weight while he
was working six days cach week.

This is only one striking example of the needless waste
of human life that is going on in the United States.

How THE ноок-
WORM DEVELOPS.
1-7, segmentation
of the egg; 8-16,
the embryo; 11,
the worm escap-

been called “the vampire of the South," ing from the
because it sucks the lifeblood of the
people. As we have learned, it burrows

shell; 12-13,
empty shells

through the skin, finds its way to the intestines, hooks
itself on to the intestinal wall, and slowly drains the

Newly Discovered Rope Worm Infections: First Case Report in
Gulf Cooperation Council Countries

Ali Sher”, Saif A. Latif?

lInfectious Diseases Hospital Laboratories, Ministry of Health, Kuwait City, Kuwait.
2North Khaitan Clinic, Ministry of Health, Kuwait City, Kuwait.

DOI: 10.4236/oalib.1108196 PDF HTML XML 28 Downloads 5,017 Views

Abstract
Rope worms are anaerobic worms that were discovered in 2009 during the cleansing of the colon by
coffee or cleansing enemas. They are rope-like meter-long intestinal parasites and look like twisted

fibres of rope attached to the intestinal wall. Thousands of people have passed the rope worms in

their stool all over the world. Aim: This study aimed to find the cause of intestinal blockage by the

worm passing in stool, identify them and treat the patient. Morphology: The rope worms look like a

rope and slimy in nature and over a meter long. They were identified in five different developmental Worm1
stages based on their morphology. Clinical Symptoms: The rope worm produces a slimy sticky Wo rm2
substance with a distinct odour, twists like a corkscrew, and may obstruct the intestine. It may also Worm3
cause abdominal pain, bloating, gases, indigestion, and constipation. Conclusion: The patients were Worm4

Never touch them
Really never touch them

treated several times in the area clinic with anthelminthic drugs with no improvement of symptoms.

The patients were unable to pass the stool without water or milk rectal enemas.

4. PARASITES

Do parasites cause symptoms of depression? LINK

HEALTH

Over 50% Of Liberal, White
Women Under 30 Have A

Mental Health Issue. Are We
Worried Yet?

BY ELIZABETH CONDRA

Define Mental Illness.

Apr 13th 2021+ (0) 7 min read

Are antidepressants designed to treat the symptoms of depression or to cure the patient of depression?
Which would be better for the patient?
Which would be better for the drug manufacturer?

Why do anti-depression medications not work in long-term studies? LINK

Do human emotions stem from chemicals secreted by glands in the human body?

Do parasites feed on the chemical secretions from these glands?

Would parasitic infection cause a chemical imbalance leading to depression and other mental illnesses?

Do antidepressants cause an artificial increase to these chemicals?

Would this result in a ‘return to normalcy’? [temporary]

Would the artificial increase of these chemical secretions [food source for parasite] result in an increase to the
number of parasites in the host?

Would this ‘increase in parasites’ once again deplete the body of the chemicals needed for mental well-being?
Would this require an increased dosage in medication to ‘return to normalcy’?

Would this increased dosage cause an even greater increase in parasites?

Why do anti-depression medications [really] not work in the long-term?

Define Addiction. j
— -

It gets worse. а

30

Can parasites cause neurological disorders?

Metabolomic signature of mouse cerebral cortex
following Toxoplasma gondii infection

Jun Ma, Jun-Jun He, Jun-Ling Hou, Chun-Xue Zhou, Fu-Kai Zhang, Hany M. Elsheikha ©) & Xing-Quan
Zhu

Parasites & Vectors 12, Article number: 373 (2019) | Cite this article

1401 Accesses | 7 Citations | 1 Altmetric | Metrics

Abstract

Background

The protozoan parasite Toxoplasma gondii infects and alters the neurotransmission in
cerebral cortex and other brain regions, leading to neurobehavioral and neuropathologic
changes in humans and animals. However, the molecules that contribute to these changes

remain largely unknown.

@ sciencealert.com/mind-altering-parasite-transmitted-by-cats-linked-to-several-brain-disorders

Mind-Altering Cat Parasite Just Go
Linked to A Whole Lot of Neurological
Disorders

HEALTH 14September 2017 By PETER DOCKRILL

Can parasites cause anxiety?

The role of parasites and pathogens in
influencing generalised anxiety and predation-

related fear in the mammalian central nervous

system

Alain Pham/Unsplash

Maya Kaushik, Poppy H.L. Lamberton, Joanne P. Webster 3, &

The brain-dwelling parasite Toxoplasma gondiiis estimated to be hosted by at
least 2 billion people around the world, and new evidence suggests the lodger
could be more dangerous than we think.

Show more v

+ AddtoMendeley 33 Cite

While the protozoan invader poses the greatest risk to developing foetuses
infected in the womb, new research suggests the parasite could alter and

amplify a range of neurological disorders, including epilepsy, Alzheimer's, and
Parkinson's, and also cancer.

https://doi.org/10.1016/j.yhbeh.2012.04.002 Get rights and со

Abstract

This article is part of a Special Issue “Neuroendocrine-Immune Axis in Health and
Disease.”

Behavioural and neurophysiological traits and responses associated with anxiety
and predation-related fear have been well documented in rodent models. Certain
parasites and pathogens which rely on predation for transmission appear able to
manipulate these, often innate, traits to increase the likelihood of their life-cycle
being completed. This can occur through a range of mechanisms, such as alteration
of hormonal and neurotransmitter communication and/or direct interference with
the neurons and brain regions that mediate behavioural expression. Whilst some
post-infection behavioural changes may reflect ‘general sickness’ or a pathological
by-product of infection, others may have a specific adaptive advantage to the
parasite and be indicative of active manipulation of host behaviour. Here we review
the key mechanisms by which anxiety and predation-related fears are controlled in
mammals, before exploring evidence for how some infectious agents may
manipulate these mechanisms. The protozoan Toxoplasma gondii, the causative agent

| just learned toxoplasmosis
exists and | have a cat so |
Googeled it. Google images
was kind enough to put my
mind at ease with this gem.

31

Can parasites eat brain tissue?

Naegleria Fowleri cases are being reported throughout certain regions of the
United States Credit: Alamy

What is brain-eating amoeba?

Naegleria fowleri, commonly referred to as the "brain-eating amoeba," is a
free-living microscopic amoeba that can cause a devastating brain disease.

The parasite enters through the nose and into the brain where it turns
into Primary Amebic Meningoencephalitis (PAM), which is a disease of the
central nervous system.

If parasites eat brain tissue, could parasites be the cause of Alzheimer's Disease?

Could Toxoplasma gondii have any role in Alzheimer
disease?

Ozge Yilmaz Kusbeci 1, Ozlem Мітап, Mehmet Yaman, Orhan Cem Aktepe, Suleyman Yazar

Affiliations + expand
PMID: 20921875 DOI: 10.1097/WAD.0b013e3181f73bc2

Abstract

Background: Alzheimer disease (AD), a chronic progressive neurodegenerative disorder, has a mainly
unknown multifactorial etiology. Neuroinflammatory mechanisms might contribute to the cascade of
events leading to neuronal degeneration. Central nervous system infections have been previously
suggested as possible etiological agents in the development of sporadic AD. Toxoplasmosis can be
associated with various neuropsychiatric disorders. In this study, we aimed to investigate the possible
association between toxoplasma infection and AD.

Methods: This study evaluated the serum anti-Toxoplasma gondii IgG levels. It included an age-
matched and sex-matched study and control groups that consisted of 34 patients with AD and 37
healthy individuals, respectively. There were no difference between the socio economic states of the
patients and control subjects. serecm anti-I-gondi IgG levels were measured by using ELISA.

Results: According to the statistical analysis, there were no significant differences among the patients
and the control participants with respect to age (68.05: 15.98, 62.91+5.89 y, P=0.072; respectively)
and sex. The seropositivity rate for anti-T. gondii IgG antibodies among AD patients and control
groups were 44.1% and 24.3%, respectively, and there was significant difference between the serum
anti-T. gondii 196 levels (Р-0.005).

Conclusions: Our findings suggest that toxoplasma infection may be involved in the pathogenetic

mechanisms of AD. If confirmed, a positive correlation between toxoplasmosis and AD may lead to
new approaches for the management of AD.

Can parasites cause schizophrenia?

Parasites as causative agents of human
affective disorders? The impact of anti-
psychotic, mood-stabilizer and anti-parasite
medication on Toxoplasma gondiis ability
to alter host behaviour

J.P Webster D, P.H.L Lamberton, С.А Donnelly and E.F Torrey
Published: 17 January 2006 https://doi.org/10.1098/rspb.2005.3413
Abstract

inderstand transmissil
infectious causation of both acute and chronic d

and neuropathological studies indicate that

dii. Reasons for this includ

Are brain-eating parasites the cause of insanity?
PSYCHOPATH

It gets worse.

33

Can parasites manipulate their host into committing suicide?

Suicidal Crickets

Hairworms have a perpetual challenge: They infect landlubbing insects like crickets,

but the parasites must make their way to an aquatic habitat in order to reproduce.

Researchers at France's Centre National de la Recherche Scientifique figured out how
they accomplish this feat. Hairworms produce mind-controlling chemicals that cause
their cricket host to move toward light. Because water bodies reflect moonlight, this

often sends crickets toward lakes and streams.

The crickets jump in and drown, and the hairworms emerge, ready to find their next

victim. 5

html

nttps://www.livescience.com/21345-t-gondii-p ite-st e-attempt

Cat Parasite Linked to Suicide Atte pts in

© American Psychiatric Association .. H umans

GAPAPsychiatric By Stephanie Pappas published July 02, 2012

The (9CDCgov is warning of an accelerating осеооо
mental health crisis among adolescents,

with more than 4 in 10 teens reporting that

they feel “persistently sad or hopeless,” and

1 іп 5 saying they have contemplated

suicide.

pubmed.ncbi.nIm.nih.gov/21

Brain parasites and suicide

David Lester |

Affiliations + expand Women infected with the cat parasite Toxoplasma gondii are more likely to

PMID: 21117467 DOI: 10.2466/12.13.PR0.107.5.424 attempt suicide than non-infected women, new research finds. The reason for
this connection, however, remains mysterious

Abstract

In a sample of 20 European nations, the prevalence of the brain parasite Toxoplasma gondii was
positively associated with national suicide rates for men and women.

@ medicalnewstoday.com/articles/24923

Common Parasite Linked To
Suicide Risk

Testing positive for a common parasite that lives in the bodies of 10 - 20% of Americans is
linked to a sevenfold higher risk of attempted suicide according to new research.

This was the main finding of a study appearing in the August issue of The Journal of Clinical

Psychiatry that supports growing evidence linking infection by the ЖЕСІРДІ) parasite
to suicide attempts.

It gets worse.

seroprevalence of antibodies to T. gondii in people with schizophrenia is significantly higher than in control populations (OR=2.73, Р<0.000001).191 A 2009 summary of studies found that suicide attempters
had far more indicative (IgG) antibodies than mental health inpatients without a suicide attempt.[19?! Infection was also shown to be associated with suicide in women over the age of 60. (P<0.005) 11931

Can parasites use epigenetics to suppress certain genes in a host?
Can it select which genes are expressed?

Т. gondii has been shown to alterithesbehavior of infected rodents in ways that increase the rodents’ chances of being preyed upon by ?еііі 11111511161 Support for this
"manipulation hypothesis" stems from studies showing T. gondii-infected rats have a decreased aversion to cat urine.'""! Because cats are the only hosts within which T.
gondii can sexually reproduce to complete and begin its lifecycle, such behavioral manipulations are thought to be evolutionary adaptations that increase the parasite's
reproductive success. |!!! The rats would not shy away from areas where cats live and would also be less able to escape should a cat try to prey on them. The primary
mechanisms of T. gondii-induced behavioral changes in rodents is now known to occur through epigenetic remodeling in neurons which govern the associated
behaviors; [7118] for example, it modifies epigenetic methylation to cause hypomethylation of arginine vasopressin-related genes in the medial amygdala to greatly
decrease predator aversion." 7/18] widespread histone-lysine acetylation in cortical astrocytes appears to be another epigenetic mechanism employed by Т. gondii.
Differences in aversion to cat urine are observed between non-infected and infected humans and sex differences within these groups were apparent, too.21]

manage it. Now a new study suggests H H
that A т can turn its host’s https:/ / archive.is/ 03yIB

genes on and off — and it's possible other parasites use this strategy.

[19][20]

Average facial landmarks

Can epigenetic remodeling change a host's
appearance?

Could it change it enough to make the
infected detectable by a trained observer?

s" -for gay

The study from Stanford University -
hich found that a computer
algorithm could correctly distinguish
between gay and straight men 8196 o
the time, and 7496 for women - has
raised questions about the biological

Ever notice that all the most
diabolical villains throughout cartoon
history all share the same
distinguishing features?

Parasitic and pathogenic fungi form symbiotic relationships
with other living organisms, similarly to mycorrhizal fungi;
however, they benefit to the detriment (and sometimes death) of
their host. Many species affect trees and other plants. Others
attack mushrooms, sometimes rendering the host species
unrecognizable.

35

If parasites can change the appearance of its host, would this explain the ‘numale’ look?

above - a fragment of the Sixte Chapel fresco
"Тһе Last Judgment" painted by Michelangelo
(1475-1564).

Below is the current mayor of Chicago.
Actions.

лом yee

Q & pubmed.ncbi.nim.nih.gov/23225875/

> J Exp Biol. 2013 Jan 1;216(Pt 1):127-33. doi: 10.1242/jeb.073635.

Influence of latent Toxoplasma infection on human

personality, physiology and morphology s Geet

cons of the Toxoplasma-human model in studying
the manipulation hypothesis

Jaroslav Flegr !

Affiliations + expand
PMID: 23225875 DOI: 10.1242/jeb.073635

Abstract

The parasitic protozoan Toxoplasma gondii infects about one-third of the population of developed
countries. The life-long presence of dormant stages of this parasite in the brain and muscular tissues
of infected humans is usually considered asymptomatic from the clinical point of view. In the past 20
years, research performed mostly on military personnel, university students, pregnant women and
blood donors has shown that this ‘asymptomatic’ disease has a large influence on various aspects of
human life.

View Same Google іб SsuceNAO Trace & bunkercuck jpg, 149KiB, 797x758
Anonymous ID:d0990zwM Mon 20 Sep 2021 21:50:05 No.340115610 ™ Report

»muh А.І. facial composites

You can change your jaw shape by keeping your tongue in place properly and eating tough foods, you can change your body
shape and even skeletal structure with diet, exercise and through physical trauma

It stands to reason that a lifelong, behavior-changing parasitic infection could do the same.

Worm pill status: taken

37

Is promiscuous sex rampant in college?
Would such promiscuous behavior expose otherwise healthy individuals to new parasitic infections?

Would such infections then cause the host to CHANGE?

МФ antes/depois

AntesDepoisDaFederal
lantes/depois

^ 1310

AntesDepoisDaFederal
lantes/depois

I$ antes/depois

My senior year of high e скен

ШЕШЕ Cropping ourmy 1st year

ке Of college
a

—

So whose gonna take one for the
team and kill Kavanaugh?

n 28.5

Can parasites turn a creature trans?

Home / Science & Nature / Marine Science

Undersea parasite turns male mud crabs
female

Marine Science, Science & Nature

The world is full of parasites that can force their hosts to do strange, even suicidal, things.
But very few can functionally switch an animals gender. One such parasite lurks in

Chesapeake Bay: an invasive barnacle that hijacks a mud crab’s reproductive system and

Image above: A mud crab
infected with parasites. The
sacs on its abdomen
contain thousands of

parasite larvae the crab will

later release into the water.

The invasive parasite

Loxothylacus panopaei
(Loxo for short) is a type of barnacle, but looks and acts nothing like the typical barnacles
growing on rocks along the shoreline. Loxo has a highly evolved life cycle, essentially
custom-made for acting as a crab parasite. As a free-swimming larva, Loxo resembles a
typical barnacle larva. A female larva infects a recently molted crab by burying into its shell.
Once inside, she undergoes a series of changes and assumes control over the host crab,

dictating major functions such as molting and reproduction.

Abstract

Gender identity disorder (GID), recently renamed gender dysphoria (GD), is a rare
condition characterized by an incongruity between gender identity and biological sex.
Clinical evidence suggests that schizophrenia occurs in patients with GID at rates higher
than in the general population and that patients with GID may have schizophrenia-like
personality traits. Conversely, patients with schizophrenia may experience alterations in
gender identity and gender role perception. Neurobiological research, including brain
imaging and studies of finger length ratio and handedness, suggests that both these
disorders are associated with altered cerebral sexual dimorphism and changes in cerebral
lateralization. Various mechanisms, such as Toxoplasma infection, reduced levels of
brain-derived neurotrophic factor (BDNF), early childhood adversity, and links with
autism spectrum disorders, may account for some of this overlap. The implications of
this association for further research are discussed.

16/0960-0760(95)00062-5.

> J Steroid Biochem Mol Biol. 1995 Jun;52 doi: 10.10

Sex hormone changes induced by the parasite lead to
feminization of the male host in murine Taenia
crassiceps cysticercosis

C Larralde 1, J Morales, | Terrazas, Т Govezensky, M С Romano

amano bapana MEN What happens if your endocrine system gets
PMID: 7779761 DOI: 10.1016/0960-0760(95)00062-5
disrupted? LINK

Abstract
Female mice are more susceptible to Taenia crassiceps (TC) infection than males, However, after a

month parasite load increases massively in both genders reaching thousands of parasites per host.
The possibility of hormonal changes in the infected mice was envisaged. Sex hormones levels were

assayed after different periods of infection, the parasites present in the peritoneal cavity were
collected and gonads, uterus and seminal vesicles were weighed. In male mice, serum estradiol
increased to levels 200 times their normal values whilst those of testosterone decreased 90% relative
to controls. The weight of seminal vesicles was significantly diminished. Infected female mice also

Watching the parasites fully transition a host can now
be seen thanks to digital recording and online upload-
ing by the infected:

Is he gay?

> м x) 001/1156

Гат Gay (Coming Out Story)

ЕЗ Gigi Gorgeous
Subscribed Ж 2299604 2,877,807 views

wm gus

Is he transgender?

b м 4) 0007408

| Am Transgender | Gigi

23 Gigi Gi
Ty Gigi Gorgeous
ý Subscribed | Ж | 239960

Is he a lesbian?

P» м 4) 004/828

I'm a Lesbian | Gigi

Gigi Gorgeous
^

Is he a dog lover?

М 4) 001/1254

| HAD SEX WITH А DOG | Gigi
5 сс Gorgeous

^

..or is he just infected? UM
41

I'll throw out a few scary facts:

fact #1: there are over 50,000 known stds

#2: we only test for 10 of them

#3: stds are caused by various types of parasjtes

#4: one of the most common parasites in the US can
cause people to become tráns.

#5: this same parasite is linked to causing suicide in the
host.

Are trans people known for high rates of suicide?

& hrcorg/news/new-study-reveals-shocking-rates-of-attempted-suicide-among-trans-adolescen

New Study Reveals Shocking
Rates of Attempted Suicide
Among Trans Adolescents

by HRCStatt - September 12, 2018

Harrowing statistics from a study revealed alarming levels of attempted suicide among

transgender youth.
Post submitted by former Editorial Producer, Print and Digital Media Rokia Hassanein

Harrowing statistics from a study recently published by the American Academy of
Pediatrics revealed alarming levels of attempted suicide among transgender youth --
with the highest rates among transgender boys and non-binary youth. The findings
emphasize the urgency of building welcoming and safe communities for LGBTQ

young people, particularly for transgender youth.

oftransgender male teens who participated in the survey reported

attempting suicide in their lifetime, while 29.9 percent of transgender female teens

said they attempted suicide. Among non-binary youth, 41.8 percent of respondents

stated that they had attempted suicide at some point in their lives.

Can parasites manipulate a host’s endocrine system? LINK

Would the same parasite that locates a different gland in a different host, then manifest different changes in

the second host?
Q @ pubmed.ncbi.nim.nih.gov/23225873/

Toxoplasma gondii infection and behaviour -
location, location, location?

Glenn A McConkey 1, Heather L Martin, Greg С Bristow, Joanne P Webster

Affiliations + expand
PMID: 23225873 PMCID: PMC3515035 DOI: 10.1242/jeb.074153
Free PMC article

Abstract

Parasite location has been proposed as an important factor in the behavioural сһапде 31 7T 1

rodents infected with the protozoan Toxoplasma gondii. During the chronic stages of infection,
encysted parasites are found in the brain but it remains unclear whether the parasite has tropism for
specific brain regions. Parasite tissue cysts are found in all brain areas with some, but not all, prior
studies reporting higher numbers located in the amygdala and frontal cortex. A stochastic process of
parasite location does not, however, seem to explain the distinct and often subtle changes observed
in rodent behaviour. One factor that could contribute to the specific changes is increased dopamine
production by T. gondii. Recently, it was found that cells encysted with parasites in the brains of
experimentally infected rodents have high levels of dopamine and that the parasite encodes a
tyrosine hydroxylase, the rate-limiting enzyme in the synthesis of this neurotransmitter. A mechanism
is proposed that could explain the behaviour changes due to parasite regulation of dopamine. This
could have important implications for T. gondii infections in humans.

If one location of the brain was infected, could March 2019 (32)- Now(35). Faking happy versus actual happy. 27 months
this result in the host acting homosexual, but if a ыды Always wanted a cute goth girlfriend, but then I became her.
different location was infected, could this result

in the host acting like a tranny?
Or a furry?

Or any other kind of degeneracy?

What are sexual fetishes?
What [really] causes sexual fetishes?

| Anonymous 03/02/12(Fri)17:39 No. 1921453

If only you knew how bad things really are

The 'numale' look is early-stage parasite infection.
The ‘Tranny’ look is late-stage.

43

Transition Complete:

Michelle Obama's librar

htups://weh.archive.org/web/20190908169014/https:/ /www.pinknews.co.uk/2017/10/1/7
an-amazing-demon-drag-queen-has-entertained-children-in-michelle-obamas-library/

Dancing with your pet worm: LINK

44

Can parasites give you a sadomasochism fetish? LINK
Have you ever wondered why some girls always fall for “bad guys"? [they are infected]

The Relation of Toxoplasma Infection and Sexual Attraction to Fear, Danger, Pain, and
Submissiveness
Jaroslav Flegr, Radim Kuba

First Published August 1, 2016 | Research Article | 8) Check for updates
https://doi.org/10.1177/1474704916659746

Article information v | Altmetric 340 Ó

Abstract

Behavioral patterns, including sexual behavioral patterns, are usually understood as biological adaptations
increasing the fitness of their carriers. Many parasites, so-called manipulators, are known to induce changes

in the behavior of their hosts to increase their own fitness. Such changes are also induced by a parasite of

cats, Toxoplasma gondii. The most remarkable change is the fatal attraction phenomenon, the switch of
infected mice's and rat's native fear of the smell of cats toward an attraction to this smell. The stimuli that
activate fear-related circuits in healthy rodents start to also activate sex-related circuits in the infected
animals. An analogy of the fatal attraction phenomenon has also been observed in infected humans}
Therefore, we tried to test a hypothesis that sexual arousal by fear-, violence-, and danger-related stimuli
occurs more frequently in Toxoplasma-infected subjects. A cross-sectional cohort study performed on 36,564
subjects (5,087 Toxoplasma free and 741 Toxoplasma infected) showed that infected and noninfected
subjects differ in their sexual behavior, fantasies, and preferences when age, health, and the size of the
place where they spent childhood were controlled (F(24, 3719) = 2.800, p < .0001). In agreement with our a

priori hypothesis, infected subjects are more often aroused by their own fear, danger, and sexual submission

Can parasites change your sexual preferences?

news.stanford.edu/news/201

brain lights up v

anticipation of ro

hown invading neurons

is are fluorescently

Why change the host’s sexual preferences?
Is it because parasites are using sex to infect new hosts?

45

Can parasites change your sexual preferences? LINK
Can parasitic infection turn you gay?

& pubmed.ncbi.nlm.nih.gov/2959888/
Q P gov

> Nutr Health. 1987;5(1-2):95-7. doi: 10.1177/026010608700500212.

The effect of fungal toxins on the sexual behaviour of
rabbits

М Nilsson 1, O Lindahl, L Lindwall

Affiliations + expand
PMID: 2959888 DOI: 10.1177/026010608700500212

Abstract

Feeding rabbits with mycelium from Fusarium roseum is shown to produce infertility, the
disappearance of aggressivity, and homosexual behaviour in males, while the effect of the females is
only infertility. This mycelium contains the mycotoxin zearalenon which has effects similar to those of
the female hormone. This fungus willingly grows on common crops and is consumed both by people
and animals-although normally in very low doses. It cannot be ruled out that an increased growth of
fungus, due to artificial fertilization, which then can be demonstrated to be found in food and
consumed, can be a factor which increases the incidence of homosexual behavior in people.

Do you have indoor plumbing?
5 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3232942/

J Clin Microbiol. 2011 Dec; 49(12): 4264—4272. PMCID: PMC3232942
doi: 10.1128/JCM.05468-11 PMID: 21976755

Widespread Occurrence of Diverse Human Pathogenic Types of the Fungus Fusarium
Detected in Plumbing Drains — +

Dylan P. б. Short, Kerry O'Donnell? Ning Zhang? Jean H. Juba,’ and David M. Geiser’

» Author information > Article notes + Copyright and License information Disclaimer

Associated Data

+ Supplementary Materials

ABSTRACT Goto: »

It has been proposed that plumbing systems might serve as a significant environmental reservoir of
human-pathogenic isolates of Fusarium. We tested this hypothesis by performing the first extensive
multilocus sequence typing (MLST) survey of plumbing drain-associated Fusarium isolates and
comparing the diversity observed to the known diversity of clinical Fusarium isolates. We sampled 471
drains, mostly in bathroom sinks, from 131 buildings in the United States using a swabbing method. We
found that 66% of sinks and 80% of buildings surveyed yielded at least one Fusarium culture. A total of

O Anonymous (ID: Ф127) zz 10/05/21(Tue)12:33:12 No.342235198 >

| had crazy anal fixation until | dewormed myself, now the thought of sticking my dick in a pooper is fucking grossing me out. what in the fuck ???
Also why do you guys buy all kind of crystal lady suplements | went to the pharmacy and just told the lady | had worms and didn't know which so she gave me some meds that
work against many kinds and took the top dose.

Homosexuals have an astoundingly high rate of infection by parasites. According to the
national institute of health, 70% of all homosexual men are infected with intestinal
parasites, as opposed to only 10% of straight men.
https://pubmed.ncbi.nlm.nih.gov/7437971/

This astoundingly high rate of infection by parasites might then explain why homosexuals
have such an increased urge to fornicate. These intestinal parasites always need new
hosts. Without a viable vector of transmission, the parasite dies. The incredibly high rate
of parasitic infection amongst the homosexual population explains why they are so
sexually degenerate. Their behavior is being altered in much the same way as the rat's
behavior is altered by toxoplasma Gondi in order to allow to parasite to survive.

=
ж

This would also explain why the media is freaking out about ivermectin. Ivermectin is
potentially the most effective parasite removing drug available. An anecdotal case in my
family gives me strong suspicion that ivermectin might actually be a cure for
homosexuality. My cousin was a homosexual, until he was prescribed ivermectin for
covid. After taking ivermectin, he filled a toilet bowl with intestinal worms. Shortly
thereafter, he lost all attraction to men, and found women sexually attractive. He was
repulsed by his previous nature.

t. gondii homosexual

Web Images Videos

Any time d

Advanced

Central-nervous-system toxoplasmosis in homosexual men and ...
https://www.ncbi.nim.nih.gov/pubmed/6691657 Anonymous View
Ann Intern Med. 1984 Jan;100(1):36-42. Central-nervous-system toxoplasmosis in homosexual

теп and parenteral drug abusers. Wong В, Gold JW, Brown AE, ...

Does Toxoplasma infection increase sexual masochism and ... - NCBI
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5731508/ Anonymous View
Nov 28, 2017 ... Other factors correlated with toxoplasmosis, e.g., zoophilia and homosexual sex

(not the homosexual orientation), had no direct relation to ...

Toxoplasma gondii - RationalWiki
https://rationalwiki.org/wiki/Toxoplasma gondii Anonymous View
Toxoplasma gondii is a parasitic protozoan that causes toxoplasmosis in humans and .... It's
possible that the initial association of T. gondii with homosexuality is ...

The Relation of Toxoplasma Infection and Sexual Attraction to Fear ...
https://journals.sagepub.com/doi/full/10.1177/1474704916659746 Anonymous View
Aug 1, 2016 ... Keywords Toxoplasma gondii, sexual behavior, sadism, sexual domination, ... It

has been, for example, suggested that male homosexuality can ..

іп a controlled study 67.596 of 200 homosexual men but only 16% of 100 heterosexual
men were found to be infected with intestinal parasites.

Is this really me? Parasites and other humans' cells in our b

https;//www.ncbi.nlm.nih.gov/pmc/articles/PMC1704818/

The emergence and spread of intestinal parasites is of public health concern
particularly in the homosexual community.

https://www.researchgate.net/publication/267 16190
_Sexual_transmission_of_intestinal_parasites_in_men_who_have_sex_with_men

These findings suggest that E. histolytica is a common commensal in the homosexual
population

https://www.nejm.org/doi/full/10.1056/NEJM 198608073 150603

76/133 (57 96) asymptomatic homosexual men harboured intestinal parasites.

https://www.tandfonline.com/doi/abs/10.3109/00365548409087142?
ournalCode-infd19

) = 10/01/21(Ғгі)22:11:23 No.341715263 >
ms.png (3.67 MB, 1300x1300)

22341699221
Fucking nuts.

When I was in Navy bootcamp circa 2011 there was a guy that came out of the head looking frightened as fuck. Something was off about him though. He was kind of walking differently, like he was іп a rush but he seemed more collected. Turns out
he filled up the shitter with worms. He said later he could see them “writhing” around in the shit. | chocked it up to the galley not cleaning and accepting subpar ingredients. But we all noticed he dropped his affected gay accent- you know the kind
that gay guys universally attempt.

Anyways, he stuck around a couple of days until he could be discharged. He didn't do the same walk or gesticulations and he stopped affecting that accent altogether. One guy, a nuke who maxed his ASVAB score, told me he thought they put
something in the food that made him shit out parasites. | though he was crazy and just assumed Occam's Razor, still assuming it was the galley's lack of cleanliness and all that. But the nuke told me one more thing: that the guy confessed to not being gay anymore.
He was revolted he told us all the shit he used to do and would like to do once he got out. He was a completely different person.

-All т saying is that maybe this is more than random 4chan bullshit posts. It's anecdotal, like OPs pic, but there's something to it all.

47

@ ncbi.nlm.nih.gov/pmc/articles/PMC269003/

m Journal of
Ea, | Clinical Microbiology’

J Clin Microbiol. 1986 Oct; 24(4): 684—685. PMCID: PMC269003
doi: 10.1128/jcm.24.4 684-685 1986 PMID: 2877006

Prevalence of enteric parasites in homosexual patients attending an outpatient clinic.
C S Peters, R Sable, W M Janda, AL Chittom, and F E Kocka

» Copyright and License information Disclaimer
This article has been cited by other articles in PMC.

Abstract

A total of 372 pooled stool specimens from 274 homosexual men with diarrhea were submitted for
parasitologic examination over a 2.5-year period. Each two-vial pooled specimen set contained
portions of stool from 3 consecutive days in Formalin and polyvinyl alcohol. Of the 274 patients, 133
(48.595) harbored one or more intestinal protozoa, with 161 (43.396) of the 372 specimens submitted
being positive for one or more organisms. The parasites identified included Entamoeba histolytica (71
patients), Giardia lamblia (22 patients), Endolimax nana (106 patients), Entamoeba coli (39 patients),
Entamoeba hartmanni (25 patients), Dientamoeba fragilis (3 patients), lodamoeba bütschlii (2
patients), and Chilomastix mesnili (2 patients). Cryptosporidium sp. (2 patients) and Isospora belli (1
patient) were also detected. Results of this study support the experience of other workers regarding
high rates of infection with intestinal parasites in the homosexual population and also indicate that
symptomatic individuals belonging to this acquired immunodeficiency syndrome risk group be
screened for both common and uncommon intestinal pathogens.

DIRECTOR ANDY SERKIS

SAYS ‘VENOM: LET THERE

BE CARNAGE’ IS A GAY

ROMANCE WITH COMING — |

OUT PARTY’ SCENE 09/30/21(Thu)08:20:50 Мо.34152

>two men infected with a parasite try to kill eachother
»its a gay romance

ЕСЕ This woman can kill the “worms” that
turned you gay

By Daniel Villarreal April 24, 2019 at 10:04am - 53 comments

TRANSLATED By

MRI «= TV

https://www. queerty.com/woman-can-kill-sperm-
hungry-anal-worms-turned-gay-20190424

г i ы ч

Dr. Mariam Al-Sohel has some meds for you, but they aren’t oral.

Meet Dr. Mariam Al-Sohel, a supposed “Kuwait! New-Age Therapist and Human Development
Advisor.” She has discovered therapeutic suppositories that'll curb your excessive homosexual urges.
That's right!

While science still struggles to understand whether homosexuality Is caused by genetics, social
factors or Just normal human desire, Al-Sohel knows what actually causes teh gay — and It ain't
genetics.

She explains: "The sexual urge develops when a person Is sexually attacked and afterwards it
persists, because there Is an anal worm that feeds on semen."

“Praise be to Allah,” the show's host says.
Related: New Pill Will “Cure” Homosexuality In 8 Sad, Delusional Months

Walt a sec... so being raped or molested somehow causes an anal worm to spontaneously grow іп
your butt? Intriguing! Please, continue doctor: “So what | did was to produce suppositories, which are
to be used by certain people at a certain time, and It cures those urges by exterminating the worm
that feeds on sperm."

ous (ID: GHEE) = 09/28/21(Tue)09:45:02 No.341254452 |» >>341254585 >>341254733 >>341256151 >>341256765

>>341253329
They release toxins into the stomach and brain. Used to Бе a fag until | detoxxed myself. Getting rid of parasites and worms isn't a meme. | broke up after detoxing myself after having a relationship for 3 years. Feels disgusting to think
back about what 1 did.

nonymous (ID: ШЕШЕ) = 09/28/21(Tue)10:40:10 No.341260569 >

>>341260021
Hope it works fren. | noticed a different after the first try, then soon after the gay went away. You might get some headaches but that's the parasites being gassed. Getting extra iodine into your system might also help as protection, but I'd
first try the shit | recommended.

nonymous (ID: CHEE) = 09/28/21(Тие)10:18:01 Мо.341258041 P >>341250681

>>341256765

>The worm made me lazy and unfocused,

Yeah same here. I never was hedonistic in the sense of fucking everything that walked past, neither was the ex, guess that is the exception to the rule. Also | started to lose weight pretty easily again, depressed moods stopped and the
alcohol and sugar cravings stopped right away, both two things parasites and worms love. Brain fog and feeling like total shit in the morning also is gone. | too feel reborn.

How to cure the Gay: LINK

49

Do homosexuality and trannyism appear to be infectious diseases, epidemiologically?

Is it far more frequent in children raised in densely populated areas?

Does it occur in some societies and not others?

Is it spreading at an accelerating rate? Number of Pediatric бепдег Сііпіс5 in 2007.

MONTANA
MINNESOTA Ottawa Montreal
11 Toronto

Define Outbreak.

New York
NU

WIJSITE солт Q

Houston

FLORIDA

NEWS

Teacher says 20 of 32
fourth-grade students
have ‘come out’ to her

Number ofpPediatric Gender Clinics in 2022

үз

as ‘LGBIQIA+’

A leaked internal message reveals the

elementary school teacher who claims

over 60 percent of her students are
LGBTQIA+ also said it is not enough’ to

just celebrate 'Queer folx.'

Are there multiple subtypes of gay men?

Are we looking at multiple opportunistic species?

Or are different "types" of gays just at different stages of the parasite's lifecycle?
Or do they represent people with active infections and people in remission?

Americans who self -identified as LGBTQ
in 2021, by generation
za 112,415 U.S. ueluti Conducted betwee

It is spreading like a disease because it is one.

,
Мі: lenials odxvx4QZ

Gen X

Бот E

Baby boomers i3

Traditionalists

20.8
10.5
т
(
а

[^]

50

bug chaser

Describes a person trying to acquire PARASITES

The doctor said, "This patient is regularly having unprotected sex with different
partners. He might be a bug chaser."

New Member
Username: Curndmp

Post Number: 1
Registered: 04-2008

Username: Vinsteri

Post Number: 32
Registered: 07-2007

Posted on Monday, June 01, 2009 - 06:35 pm:

I met this dude online today. Big 8 1/2 poz dick. I got him talking
about it. Said his strain was strong. Lethal. Toxic. Poison. My dick
fuking sprang up and I started begging him.

I went over... I started hitting my pipe, he did a slam. I licked him
blood off his arm. I had to have his strain. I wanted him to infect me
so bad.

I was begging for it and he went to the bathroom. He came back
with a syringe full of his blood. I'd never had another dude's blood
before. 1 stuck my hole up and he shot it inside me.. scratching
around. Then he fucked me and he shot.. mixing his babies with his
toxic blood.

So fucking hot. I know I'm gonna get a whole fuck flu from this shit.
It's so strong.

Then I went to the bookstore and let 5 dudes fuck me and grind it
all into me. I'd never had something so hot inside me. I had to get it
to take.

He's gonna start knocking me up regularly and 1 can't wait till his
shit is saturating me and producing inside of me. Woof.

Posted on Monday, June 01, 2009 - 07:35 pm:
FUCKING HOT. GO FOR IT. I WOULD

Posted on Monday, June 01, 2009 - 07:39 pm:

Wow. Made me instanTly hard. Did you hiT the pipe, too? Or slam?

Posted on Tuesday, June 02, 2009 - 12:05 pm:

that sounds fucking hot man, love feedin on blood like that too and
love tops gettin off on sharing all they've got

51

P Я r/TrueOffMyChest [ Join | t1 Toxic Masc @ Retweeted
u/ButteredSalmon * 1y

Poz Breeder
А 4 я @PozBreeder
As a bug chaser, going out in public

without a mask is very sexually exciting. My fave pig І knocked up and who | still

Many people think bug chasing is limited to the breed just found out he knocked up his

reception HIV, however to some people like myself, first bottom bitch. My strain lives on.
catching other diseases can provide the same kind #poz #gifted #bbbh
of thrill that a bug chaser gets when being intimate

with someone who has HIV. ТҮРЕН ҚАРЫНЫ

The other day | walked into my local supermarket 7 Retweets 32 Likes

and immediately felt a tingle of sexual excitement

as | was the only one in sight without a mask on.

As | continued through the store | found myself Q у Q М
walking against the guided routes that shoppers

are supposed to follow and breathing as heavily as Ф Larry Hewes & @Poz4Chasers · 2d
possible to satisfy my sexual desires. Even the looks Replying to @PozBreeder

| got from the Karens couldn't stop the rush | was Congratulations on your new "grandson"! So
getting. | know that wearing a mask and following glad to hear that his "father" is still toxic. Are
safety procedures is extremely important right now, you still toxic? And аге any of you 3 guys

i 1 "aeree qum s
but | have never felt so alive than | was when I was in interested In being Gifters? There are a hundred
that store chasers for every Gifter globally. | am glad to

refer all Gifters to chasers in their area.

T Vote ғ, C) 5 ac Share Tweet your reply

Q r/CuckoldCommunity
"ee >

The bull is HIV positive
| NSFW |

I've been rock hard since І found out. |
talked to my wife and she promised that
he'd always be wearing a condom. My
wife is currently pregnant and the idea
that only a thin bit of latex prevents his
supercharged POZZED load from
infecting my wife and her baby is the
most erotic thing ever!

85598100 >>388598919 >>388599486 >>388599500 >>388599648 >>388600076 >>388600376 >>388600575 >>388600676 >>388601460

Toxic: Carrying AlDS/other diseases.

Strain: The strain of HIV a person is carrying which they imaginarily lend significance and empowerment to, claiming their strain is strong and others should want to be infected with
it

Gifter: Someone who gives the gift of AIDS to others.

Bug chaser: Someone who actively seeks out and fetishizes infection by AIDS as the gay version of getting pregnant

Breeding: Ejaculating inside another man's rectum with HIV positive semen to infect them with the virus

Impregnating: Infecting someone with the virus

IV Drip: Doing a direct blood transfusion of a gifter's AIDS blood

Funneling: Accumulating numerous positive men's semen into a container and pouring it into an opened rectum with a funnel for the purpose of infection with AIDS

Doublebugged (and triple, quadruple, etc): Being infected with multiple strains of AIDS from multiple gifters intentionally.

Pig: A submissive male who enjoys being penetrated by other males and in particular enjoys it in an unclean manner involving unshowered, sweaty men often with an element of
feces or urine.

San Francisco Special: Having a party in which multiple gifters infect other bugchasers with the virus as the basis of the gathering

Initiation: A ceremonial infection of a new gifter to begin breeding and impregnating others with AIDS.

Xenomorph: An HIV positive gay man who preys on negative gay men to infect them without them knowing, and then is sexually aroused by the thought of the virus surprising them
from within their bodies like giving birth to a horrible monstrosity.

Cocktail: A mixture of multiple HIV positive men's semen

Sounding Spreading: The spreading of the AIDS virus by injecting infected semen into the urethra of the recipient instead of the rectum

Black Bug Chasers: Gay men who specifically seek out infection with HIV from black men under believe that black HIV is superior.

Zyklon-B: A term used to refer to infected semen being put into a Jewish gay man.

Why do social media platforms censor facts but allow pedophilia advocates? LINK
Why is pedophilia protected by those with power? LINK

Is there an advantage to the parasite when the parasite infects a young host?

Does a child's weaker immune system make it more susceptible to parasite infection?

Worms in childhood

Category: Child Health
Topic: Infections and Parasites
Ез Send by email [xj Viewas PDF &3 Send by post

Threadworms, also called pinworms, are tiny, very thin white worms about 5 millimetres
long that live in the intestine and around the anus (bottom). They are very common and
widespread in Australia and are easily treated. Although people of any age can get them,
with the infection spread through worm eggs on
contaminated surfaces. Infection with other worms such as roundworms, hookworms
and tapeworms is less common.

Can the parasite gain greater control over the host the longer the parasite remains inside the host?
How do homosexuals reproduce?

Do parasites influence the host to engage in pedophilia in order to spread to more vulnerable hosts?
Who is Wilhelm Reich?

Why did he conclude that sexual degeneracy was communicable?

What is the average age of a homosexual's first sexual encounter?

How do homosexuals [really] reproduce?

RAMROD - ^ Description
etka: Alex Garcia бола .» RAMROD, South Florida's Levi/Leather/Uniform/Bear Bar is the South's #1
About > Yesterday at 1108 AM Cruise bar.
Discussi

ies ATTENTION!!! Ramrod is a Leather,Levi and Uniform Bar. We are
| Alex's post welcoming to all Patrons that identify as such. Leather/Kinkster Folks of all
Members identities are welcome and will be treated with Respect. Ramrod does not
Events BI condone any Racist, Transphobic, ог Misogynistic Behavior in our

establishment. Also remember Consent is not just sexy its MANDATORY!!!

Videos

How old were you the first

Files time you had dick? month. Great Music and tons of fun to ensure that this will be a party you
don't want to miss.

Photos Pig Dance is an institution here in South Florida. 1st Saturday of every

Recommendations

The 3rd Friday of Every month we host ManDance, this is the biggest Bear

h oup Q
CUT Я Dance Party in town. Hosts some of the hottest DJs in town.
Jeff CubHunter 6 5g J Paul-Anthony Andrada 6, Played Dr. @ an early age. With school Ej Denis Sabol 13
Like - 1d оа 5 Е kids my own аде!!!!Кеаѕоп why I'm Top/Vers. 1
Оов Like · 1а
А 5 Like - 1d - Edited "
i SELIM GRD 15) у Lj Sosa | think | was around 7. It was just curious boy stuff.
Like - 1d (ез Rob Velasco 17 Like - 1d Оз:
Mido Mido Craig J. Chamber! t pus
ido Mido Crai amberlain i want you
E 9 ! y Жж Rober Isidoro Gomez Castillejo 14 ma
Like - 4h ve | Jerry Meek 19 i Gerald Johnson 5
1 Like - 1d - Edited а= n
Like - 1d Like · 1d
Michael Wesley 14
b Tips ud E Jose Calera 14 | was and still am the bottom ЖЕ E
Like - 1d 2 David McCartney Was born with one. О Dominick King 8 years old
a Like - 1d Ов :
Like - 1d 5 Like - 1d
Louis C Harris 10 =a
A > - a Paul Wright 8 Qi з :
Like · 1d 2 Kerry Herbags 21. | think | was a late bloomer. dir David Hughes 9
ike 3
Like - 1d Like - 1d
Jordan Miguel Adı 16
"n ordan Miguel Adorno A Mark Reilly 12 '
Like - 1d vd Brian Thornton 14 Qa? Kk Jesus Ramirez 7
Like - 1d ры
М | m 4 2 Like - 1d Like - 1d
ayne Smith 1
И 2 m Velvet Hammerschidt 12
Like - 1d Chad Davis So early | can't remember Qa? т Adam Gregory 15 іп a glory hole in public toilets
282 Р Like - 1d Os:
Mi R Obert LeFevre 18 asia Like - 1d
rt
Бы лд Аы 6 Rodney Nelson 11
Like - 1d кі Donnie Wayne 6 - 7 Qu [| Jerry Schooley 10.... with neighbors grandson on top of sta
m Qoa: Like - 1d old newspapers in her garage ! Still love that ink smell! e

53

ВЕ Kelly Farmer 14
О:

Like · 1d

E Mido Mido Kelly Farmer so handsome

Like - 4h

Like - 1d

Bl Dane Sheldon Rod Paul Andrés Exactly the same!

Like - 1d

a John Perry 13
Like - 1d o:

Darrll Morales 20
Like - 1d

Rod Paul Andrés 4 but the first time | enjoyed it was 16

«225

о 2 Like - 1d

ж Hide 14 Replies

Ronald L Peck 13
Like - 1d

Gary Simons 16
Like 14

Chet Ford 8 with a cousin who was 12 and һе has a 11.5 inch cock I
think that's why | am a bottom now

Ose"

Qo:

Mark Miller-Schott 10
mas

Е

Bob Lilly 611 (is 5
Like · 1d

Like - 1d - Edited

Philip La Vigna was 5 grade. but relly around 5 with a boy г

Like - 1d

Michael Harness 15
Like - 1d

E Bob Lilly It was a cousin and we fooled around for years.

о:

Rod Раш Andrés Dane, don't get me wrong, it wasn't
horrible, | just couldn't comprehend what was really
happening. It began at 4 could have been a little earlier, |
have some strange memories but can't be certain they're not
manufactured, and went through 13 with various individuals.

When 16, | became involved with a military person 20 years
older... looking back | recognize that these individuals were
child predators. No harm, | survived and don't have any ill will
towards them.

[E

Like 14

Dane Sheldon | was tied to a tree and forced to perform oral.
Had numerous additional unwelcome experiences. Finally had
a nice experience when | was in my late teens. Still harbor
some resentment towards the original perpetrator but have
become comfortable with myself, with who | am, and what |
enjoy (albeit a little different than most).

Like · 1d a
N Eric Heiselt 15 - scout camp; real sex was 18 with my hockey
coach
4
Like - 1d os

У

Ally Тот Ifamilik М Eric Heiselt that must be hot??
Like - 23h

М Eric Heiselt Ally Tom Ifamilik didn't appreciate it then. But |
still love a hairy daddy with a touch of silver. Yummm

Like - 23h

View 4 more replies

Mark Williams 19... Raped by my dad in 5th & 6 th grades but.
8

Like

м

1d - Edited

Ally Tom Ifamilik Mark Williams for real tho?? No way.
Like - 23h

Mark Williams Ally, | entered male survivors of sexual abuse
therapy in January 2011. Finally, | began to deal with the loss
of my childhood.

О:

Like - 21h

Like - 1d

M Bob Bier Chet Ford hopefully you and your cousin still hook

up
Like - 1d

e:

Chet Ford Bob Bier no we haven't hooked up since he was
19 and | was 15

Like - 1d

Mark Parker Chet Ford wow! Start big or go һоте!!
Like · 1d

Chet Ford Mark Parker it hurt like hell. Got used to it when I

was 12

Like - 1d o р
Bob Bier Chet Ford 4 years of hurt, that's a long time

Like · 1d

Chet Ford Bob Bier well we didn't see each other that much
between the first time and until | was 12 then | started to like
it. That might be why I like big cock now. Don't get me wrong
a nice average cock is nice but the bigger ones are nicer

Like - 1d

Fredrick McLeod | was raped by my dad at 3

Ва

|Ы Kelly Paris sorry to hear that!

Шке 1d

Fred Mclean Fredrick McLeod so sorry to read that
Like - d o:

Fredrick McLeod He raped me again at 18. The only reason
| even went back around him was for my grandmother. Now |
am free from him.

ё

Like - 22h

L
Те О:
ke]

Draigh Lunara 12 and a half

Ally Tom Ifamilik Mark Williams man | dont understand
stand.. your dad raped you?? That is nuts..

Like · 18h

David Andreas VonLuvinbalz 12. Red head 9” older Daddy

Ose:

Like - 1d

к

Bob Bier David Andreas VonLuvinbalz voluntary?
Like · 1а

David Andreas VonLuvinbalz Bob Bier yes. | initiated
Like - 14h

dia Оз:

Z£ABABEH PEP E

Brent Ard Somewhere between 8-10.

Оз:

Like - 1d

Mike Stonecypher 11

Like - 1d
Like - 1d

Leoke Picqueur 8

Оз:

Like - 1d

Colt Harrell 7 3
Jose Rivera 14 delicious Оз

о 1 Like - 1d
Like - 1d

Brad York 11 with a cousin
Brent Thomas Hill 16

Like - 1d 05 2
Like - 1d

Alex Warner 17 honestly
George Fain 20

Like - 1d
Like 14

Edmund DeSantis 23
Andrew Jones 13 QQ 2

Like - 1d
Like - 1d - Edited
Joe Paul 17
Daniel Miles 14
Like - 1d
Like · 1d
Scott Smith 7 4
David Ayotte 24 Оз
Like - 1d
Like - 1d

Rod Reynolds 17
Lie Id

кимна ШЕН

Stephen Folse 12

Q:

Like · 1d

Brian Young-Walls 7, with my best friend.

Like 1d Оз s

Jeff Beacom 10 with a kid my own age. 16 with a guy in his 30s

Mark Hill 11 (Du 1

Like - 1d

Like - 1d

Like - 1d - Edited

Like - 1d
Ted Moxley ! guess 8 or 9 playin with buddies mine was always
hard theirs weren't... &&
Ой:

Chen Elbilia 5-6 raped by a neighbor

9:

к Bob Bier Chen Elbilia @

Like - 1d

Norman Stanbury 11
Like - 1d о:

Bob Bier 26 for blow, 28 for anal
От

о 2 Like - 1d

Henry Martin 13

1
Like - 1d

Chris Perez 5 (Dis 5
Like - 1d

Greg Nixon 14
Like - 1d

Michael Hoyh 7
Оз:

Like - 1d

Gary Robert Potter 14
Like - 1d

Scott Haldeman 12
Like - 1d 2 2

Matthew J. Zafferas 12

Like - 1d

Eric Gunderson 11
0:

li EE Eg EE HW

Like - 1d

ою

54

EOS ju

БЕРР

Like · 1d

Like - 1d

Like · 1d

Allen Belluomini 18. Late bloomer. But I've made up for lost time.

02%:

Like - 1d

Jim Madigan 12
Like · 1d

Casey Lloyd Ford 14
Like - 1d ;

David Wasserman 5 or 6
Like · 1d » 6

Bob Lilly David Wasserman me tool

Qa:

Like - 1d

David Wasserman Bob Lilly My brother's and my best
friend's

lá
Оз:

Like - 1d

Bob Lilly David Wasserman my cousin and his friend they
were in their teens!!! And my father did too! | didn't like that at
all. But had too!!! Ugh! He finally moved away with another

guyl
1
Like - td @

Bob Lilly My father | mean. But the others were greatll!

Like · 23h

Billy Bowles 12

Like - 4d j

Filimon Campos 16
Like - 1d

Mike Roth 11 (Dis 2
Like - 1d

Brent Ard Somewhere between 8-10.

Oa:

Like 14

Mike Stonecypher 11

Like - 1d

John Whitlock 24
Like - 1d

Justin Richardson 11

ues Ой?
Matías Roberto 16
Like · 1d

Joshua Bowman 12

о:

Like - 1d

Arthur Danby 14
Like - 1d

Richard Navarro-Vincent 25
Like · 1d
Joe Murray 12

2

Like 1d

Dave Carey 7 ©) 4
Like - 1d

Ronald Podesta | was 10

3
Like - 1d Өз
Chad A-bomb Prince 21
Like - 1d

Scott Smith 7 to 14 much older cousin
14 to 18 Reverend Foxworthy

[E

Jay Dick 13
Like «© p

Michael Hochhalter 8

On:

David Kerr 8 Э | Michael Vargas | was б not going into details to dark and pervy for
Like - 1d 0: the book. Enjoy ur day oa: John Gonzales 12 on an 18 year old hairy guy &&
Like - 1d Like - 1d
Roberto Vela 37
Like - 1d MI Bob Bier Michael Vargas willing & or forced 3 ? Angelo Russo 20 with а fiend |5 very beautiful
Like 1d Like - 1d - Edited

William R Altmeyer 21

Michael Vargas Bob Bier mixed Leo-Hubert G Kelly 13 or 14

Like - 1d
Like · 1d Like - 1d
William Dangler 12
Qo? Kelly Paris Happened to me at the same age as well Jackie L Walton 34
Like · 1а
Like 1а Like - 1d

Rik Hepner Womb outing day, was part of my original equipment

Michael Vargas Kelly Paris so u get it Kevin T Casey 8

E Fok SE

Dennis Eveleigh 43
Tom Penman 15 Michael Peacock 7 Like - 1d "

Like - 1d
Like - 1d о У Like · 1d Ou?
Gordon Nesheim 14
Uke 1d strict Catholic upbringing 3
Like - 1d
Ruben Ortiz 11 a
meta о 1 3 Wyatt Greenmen Was а couple older boys about 16. |
" a Kelly Paris Michael Vargas yeah. Not sure if your experience remember incredible excitement. Would re-live it in a
was like mine, but there ya have it. heartbeat ...
Derek Bennett 4 or 5. Next time was much later, thank god O82
os Like · 1d Like · 1d
Like - 1d
ғ Michael Vargas Yea my father raised те... alone... just hima Ef Wyatt Greenmen Not sure what the teary face is for!
Omega J LaRue 9 andi Like - 13h
2 іке
like- 4d Ox? Like · 14 o
Rene Martin Murillo 9-10 Tony Rocha 43
о 2 1 Е Tai Toki-Rogers 11, the boy next door. We were at it until | turned wa Joe Skelly 11
Like · 1d Like - 1d 17 1
А о > Like · 1d
3 K Like - 1d »
1 bill; Richard Surles Jr 14
Ellas Abilama 22 №. Jose 5 Hernandez DAMN | Was The Neighborhood Slut
Like · 1d Like - 1d m William Jones Ten year old Can't Even Remember My Age
о 1 | Was In Grade School LOL
Garret Coleman | was 10 Jere Douglas 8 Eee Like - 1d
1 2
Like · 1d © Like - 1d E James Beaton 11
өй Mason Wagoner 17
Carl m] 2 Eee ESS) cu" Like - 1d ;
Like - 1d Like 14 Е Clint McKellar 22 <
o: LE] Ole AHemness 7
Keith Boswell 22 Sebastian Alex 24 oiii Lie - td
Like - td Like - 1d & уд
Albert Hoffman 6
David Leh 12 Michael n a. renee Like - 4d :
Like - 1а Like - 1d E] Anthony Vito Raimondi 16 with a classmate
к Vaibhav Dhariwal 15
Like - 1d
David Aird 21 Doug Bowers 22 Like - 1d
Like 14 Like - 1d A

Josh Becker 12 Bi

1 Flint Ternes 14
Like - 1d Like 14 o Ken Dunning 11/12 1
Like - 1d David Edgar 14
5 ? Like - 1d
Jan Rejfek | had always dick 25 Richard Brown 16 Like - 1d
2 Michael Gee 14

Like - 1d Like - 1d

Like - 1d
Robert Ledwell 12

Like · 1d

Mario Andre Quiroz 15
Jonathan Goeldner 12, with a friend doing an overnight
Like - 1d Oo:
Like - 1d

Michael Booth 6 but first full on man to man sex when | knew what |

JOUET wanted was at 16 lost my anal virginity at a tender age of 48

Chadwick Gray 10. With my best friends brother next door. He was

12 at the time.
Like - td Like - 1d Os: ©?
Like - 1d
М сааи James Long Townsend 14
Шке · 1d 4 Michael Morejon 10.
Like · 1d a о 1
Like - 14
Willem Marais 16 Randy Frazer 12yo
Like · 1d e Jeffrey Todd Ollom 13
Like - 1d ID 21

Like - 1d
Colin De Jongh us Jeff Kendall 45

Like - 1d

Michael Fellenz 9
От

Like 1d

Like 1d
Hugh Grant 23 ish

Like - 1d

Jerry Calderon 16
Lee Hamilton 14 and loved it
Like · 1d
Like - 1d
Luke а те John Рашк 15

Like · 1d Mark A Geraghty 12 but it wasn't consent

Like - 1d
Like - 1d Жы?

Tony Kaplan 18 my step brother Timothy Saathoff 13 with my best friend

Like - 1d

B eM:

Chris McGaughey 10 in showers after p.e

B mE: X€zmoMEUmseu s»mGgHY3»» Ó3»"m:gus-eor

he oe eee a AMANRNAR

Like - 1d Qo?
Like - 1d
Mickey Braden 12
Ref Cagle-Foster 7 :
Like - 1d Larry Avi Lucas Macias 15 and it was Hugh and hut &3 2, Fred Lewis 14
Like - 1d - Edited —

Like - 1d

RL Adams Last week! 92 @

Like - 1d о ы

Lee Mcallister good lord so many of you where so young ,, те |
was 19

Like - 1d o:

Gerald Shockley 14
Like - 1d

Craig Pennison 14 after school Darwin Israel 15

ШІ Ken Leedham Lee Mcallister | was 12 and loved every

moment Like · 1d Like - 1d

Like - 23h СА

"S Jackson Stivers 13 Ryan Koch-Cate 23
Like - 1d Like - 1d

Elvar Jakobsson 16

Like · 1d Randy Friedman 18 Brian OBrien 15

Like - 1d Like - 1d

Ed Gary Poole Don't remember. The neighbor boys and | played
naked it our tree fort a lot. One older boy like to be tied up and
spanked. | think | lived in a kinky wooded suburb looking back on it.

mom
ERES Zziul

E.A. Sabol Consenting, | was 11. Without my consent, | was a Joseph James Brennan 12. Haven't stopped since
toddler. Tome 02:

Like - 1d
Like - 1d LEE
55

zz aEGENMOSO:

нсана A

Chris Nevins 4th or 5th grade! 9 or 10

Steve Nolan 15 or so. 1st cousin about 2 years older broke me in.

Wilfred D Tremblay 13

1
Like - 1d Like - 1d o Like - 1d
Paul Breakiron Gave my first blow job at 16......it was with consent Уш George Hughes 14. Buti was raised in midtown Manhattan. ES Dennis Benson Depends - willingly ~ 15.
Like - 1d Like - 4d Like - td o:
ЕЕ Jamie Solomon Paul Breakiron your very sexy ғ Eddie Hughes 11. Gave ту 1st blow job to a neighborhood best Ы Ben Bristow 13
Like - 1d тета o: Like - 4d
Like - 1d
Billy White 7 " id Charles Randall 10
— zh David Hopkins 24 зерт 1
Like - 1d
Bryon Juarez 13, my Cousin ші Bishop Andrew 16
Like - 1d By Benjamin DeLee 8
ike O82 Like - 1d
Like - 1d
Anderson M. Christopher 12 а Raven Oh 17
Ж John Каре Benjamin DeLee really!?
Like 1d Like · 1d
Like - 1d
Kerry Chapman 3rd grade m Stephen Robinson 22 but I'm tied with McDonald's now... over a
regen BN Benjamin DeLee indeed Billion served
ike
Like · 23h Like - 1d - Edited Os :
Lou Gonzales Yesterday y
Like - 1d Os Wilfred D Tremblay 13 J Charles Michaelson 14. A few weeks after | lost my virginity to my
Like - 1d then girlfriend
Samuel Vanwert 11 | was a early bloomer loved it then love it now Like - 1d
and I'm 63 E Dennis Benson Depends - willingly — 15.
Like · 1d Q: Like - 1а o: ә John Paver 9 Ken Irvine 12 or 13.
Like - 1d Like - 23h
Mike Harrison 5 years old haven't stopped yet am 63 now is Tony Englefield 9
Like 1а оё: teu O: A William Hugh Moultrie 12 Irving Smith Convertino 16
Like - 1d Like - 23h
ІН Glenn Monte Mike Harrison that's sad 1:4) Alex Panagopoulos 13
Like - 23h T o: Е Edward Cichocki 9 Jose 255 8.
Like 1d Like - 23h
ГЕ | Mike Harrison Glenn Monte | know it wasn't а good thing but 4, Michael Wilshinsky 14
really did want it and liked it i
Q: Like - 1d ) Terrell Cleland 14 Monte Miller 15
Like 23Һ
А Like · 1d Like - 23h
" 5 Danny Douglas 26
| | Rene Ortiz Mike Harrison me too. | was really bad. Год — 1 = Michael Hubbard 9 James Arnold 7
ыды Like - 1d Like - 23h :
TS ille 18.1 Th SUN ЕН Ж Parker Раш 16, but if we're counting being molested 4
rev Summerville 18. In a sauna. The guy was al sucke 4 Victor Rietveld 10
him off and spat it out. then he sucked me and swallowed the lot. Like - 1d 2 Е? Daniel Huffman 18 Ы >
Never saw him again Like - 1d Like - 23h
ob Lilly Parker Paul
Like - 1d 1 Bob Lilly Parker Paul
[8 Jim Gallucci 16 Wilton Knight 10
Lee Gunner Was | think 7 or 8 ( dark times ) not given willingly Like - 1d Like - 1d Like - 23h

Like - 23h “ р

Staash Lazarick First time a guy had MY аск. І was 13. һе was 20
2

Like - 23h

Ken Phillips 19
Like · 23h

Brad Martin 9 or 10
Like · 23h

Russell Elenz 13 and never have know anything other than теп!

Like - 23h
Manny M. Ж Jeb Montoya 18
Like - 23h Like - 23h
a Grover Tesser Manny Velez atta boy 7 14 a Brodie Yg 13
Like · 23h Like - 23h
= Rexx Pike 13
Like - 23h
m Rick Marion 12

Like - 23h

Eddy va ЕЕЕ
2
Like - 23h

Ы Grover Tesser Eddy Martinez @xeellentil You needed dick.
4%

Like · 23h

Edward Wanda Wednesday Sawyer 10 he was 12
Like - 22h о 1

Ronald Akin 24
Like - 22h

Edward Costello 14

Like - 22h
Mike Davis 4 or 5
ше 2љ ©?

Grover Tesser Mike Davis man after my heart. Wish ме had
been neighbors sneaking around to share cocks.

о:

Like - 22h

Daimeon Pilcher doesn't mean you weren't molested. A 5
year old isn't expected to fully know wrong from right and the
person you were with took advantage of that.

От

Like - 22h

Grover Tesser Serious dick with cum 9
He was older. Played p p at 6 with chums of same age.

OB:

Like - 23h

E Bob Lilly Grover Tesser oops!!! Did not mean angry!!! Sorry.
Like - 23h

Grover Tesser Bob Lilly No problem if you did mean it. | was
having a great time. 7%”
О:

Like - 23h

Bob Lilly Grover Tesser no didn't mean ІШІ | was having fun
then 100!!!

Шке: 1d

Kelly Paris Grover, how old was the guy you had fun with
when you were 9?

Like 14

Grover Tesser Bob Lilly if guys are honest..]| bet 87% of us.
o5

Like 14

ЖІ Bob Lilly Grover Tesser so ітие! | really enjoyed ІШІ
1
Like- 1d

Thomas Farley 12

1
Like - 23h

George Dominguez 9

1
Like - 22h

Darrell Moore 12

Like - 22h

Like - 22h

Shawn P Murphy 13
2

Like - 22h

Antonio Miguel Spinoza Following, 13
Like - 22h

B Spencer Richards | was 18 the first time | had a man cock
От
©

Bob A. RaNeses 21, college buddy

Like - 22h

56

EY

Jimmy Brindle | was 15

1
Like - 23h о
Е Kirt Schellhaas 23
e: Robert Brown 10
Like - 23h 2
Like - 23h
Jacks Von Liria 14
Charlie Junke 13
Like · 23h
Like - 23h
Craig Warner 13
Samuel Bojorquez 12
Like - 23h

V
Ai
-
&
Е
e
e

Like - 23h
David Mellinger 20

Philip Smith 8
Like - 23h

Like - 23h

Scott Masters 16
Like - 23h

Adam Walder Probably around 13
Like - 23h

Manny Velez 8 years old BJ LaRouech 11

2 1
Like - 23h Like - 1d о
Lary Wayne Wadsworth 7
Q?
Like - 23h

Michael Gordon 5
Like - 23h

B Michael Gordon ves

От

Like - 23h

E Michael Gordon | always was gay no women here
Like - 23h

Richard Barragan 5 years old

2$:

Like - 23h

Perry Hummer 12
Like - 23h

Jaime PB 21
Like - 23h

Allan Spach 12
Like - 23h

Michael Greck 13

Like - 23h

|
ШІ ^

Jim Martin 11
Like - 21h
Danny Dupree 6 neighbor friend

Like - 21h o:

а Grover Теѕѕег Danny Dupree yes Danny. And what a
beautiful name. It just feels good in mouth and even better
when it rolls past my lips. Great name buddy. 9)

Like - 21h

Alex Ray 11 Q 1
Like - 21h

Guy D Broome 5
Like - 21h

Michael Edwards 12

Os:

Like - 20h

[^3 Jaycee Hammer Did your older brother top you?
Like - 20h

Scott Coleman Michael Edwards me tool 4 2 &
Like - 20h

Michael Edwards Jaycee Hammer no
Like - 20h

Rodney Davis 15
Like · 20h

Steven Rees 13 years old
Like - 20h

Harry Orama | was very young 5ish 6.it was my uncle,

| thought you had to be with men, | did like it, one of my favorite role
model was "speed racer”

| remember one time kissing the t.v cartoon character and my mom
saw me and she's like, no you don't do that, | was like really , but i
love this man mom, well at least in my mind | told her, but i was.
smart, | start it doing behind her back! Hehe

The time | was with a woman was back in 1985, never looked back !

О:

Like - 20h

Joseph Bernard Snyder 6 yrs old

Like - 19h :

Brandon Perez Emnace Id never fucked but oral, | do at 9. Only
oral up until now, but never fucked a guy.

Like - 19h - Edited

Scott Carpenter 11

© 8

Mickey W. Kean 15

Christopher James Shipp Touched my uncles cock when | was 5!
Had sex when | was 19
Оё:

Like - 21h - Edited

E Bob Lilly Christopher James Shipp he never said anything?
Like - 21h

Patrick M Kearns 18yrs
Like - 21h

Erik S Malm 30
Like - 21h

Damien Ruud 21
Like - 21h o :
Anthony Alleycat Fióre 15

Like · 21h

Jeff T Huckaby 10, the 14 year old boy across the street... and the
11 year old boy on the corner. Sleepevers galore with the three of
us. Good times. Lots of frottage and touching.

От

Like - 21h Edited

Dean Davis 6
Like - 21h o:

Dan Gerrell 9 ©) 2
Like - 20h

[1 Dan Gerrell No need to cry, it was with an 11 y/o and boys
were boys... shit Magnum PI changed my life before that
happened... Lol

ғ

Like - 18h - Edited

Alec Edwin Porter 7-8

к ei

Like - 20h

Ey Edward Paul Alec Edwin Porter same
Like · 19h

ЁЙ Steve Steffen Edward Paul , thats too bad, soo not right
Like - 19h

Patt Copeland-Griggs 16
Like - 20h

Brad Diffenderfer 13, my brothers BFF. Off and on for 2-3 years.

Like - 19h

Nightwolfe Lockwood-Park 6

E ет

Like · 19h

Tony King-Watkins Oral 8, anal 16
Like - 21h o:
E Bob Lilly Tony King-Watkins who at 8?

Like · 21h

Bi Tony King-Watkins Bob Lilly my 16 year old foster brother

Qo:

Like · 21h

Bob Lilly Tony King-Watkins my 15 year old cousin started
me on him at 5. He had me sucking him for many yrs. Untill
he got married.

Like 21h

Tim Harter 15 and have loved it ever since
Like · 21h
Brandon Coon 12 years old, Boy Scout camping trip. Shared a tent
with three other guys.

1
Like - 20h o

Scotty Allen 16
Like - 20h

Jordan Clevenger My current age, 2122

о:

Like - 20h

Jack Harrold 14
Like - 20h

Douglas OKeeffe Oral 20, anal 21
Like - 20h

Michael Dalme 25. | made up for it though lol
Like - 20h

Greig Shortreed 12

[E

Like - 20h

Bryan Greeley 15 with a 24 yr old and | thought he was old
Like - 20h

Marq Kerr 17 didnt like it thought | wasnt gay until | fuck a guy when
I was 20

Like · 19h

Eddy Cross 4
Like - 19h

ШІ Eday cross why the frown face nun?

Like - 4m

Gary Morse 8 my neighbors son until 11

Like - 19h
Like - 18h Ш Don Jones Way before | was a teenager, | don’t even know the Like - 19h
Pasquale Valentino 15 СЕ e: x
T Brandon Corbitt 8 Like - 19h 83 Scott Smith 9 "al Clint Bordwell 5
ike
Like - 48h Like - 18h isch 0)
Markus Georg Enders 7 John Paulk 14
Like - 19h С m Merk Jones 16 Like - 18h Mike Allshouse 10 Chris Capps 18
ike
Like - 18h Like - 18h Like - 16h
Mitch Orr 8 L Sion Corn My own when | was about six ^
— $ Thom Lauth 21 AETA оо 2 Anthony Galvin 8 Kevin Wright 24
Like - 18h Like - 17h Like - 16h
i Jeff Osmond 11 1
саша 79 B p Mark Porter | was born with a dick?
Like - 19h I eet Like - 18h Р) E Randy Crank-Heflin 18
Like - 18h Like - 17h
Е = Like - 16h
Jamie Todd YT 10 to suck 13 getting fucked E Dene ataa am OE
Like - 19h 02: WHEE EES Like · 18h Troy Duncan In my late 30s ІШІ
Like - 18h 5 Like - 17h igs
Like - 16h
Mark Dwayne Turberville Jr. 13
Stephen Jackson 11 L5] dp ke] Paul Holbrook 13
ike Arthur Silver 12
Eie don Like · 17h FN
ii Like - 16h
Heath NaughTeeboy Tanner 9 with my older brother and then 11 Scott Clink 15 ЕҢ Philip J Morganti 8
with my 23 year old neighbor. Still play with brother on occasion. Yup Like - 17h 11 Robert Dulworth 12
I'm a total pig! Like - 17h
Like - 16h Оза: [3 Ben Rice 21 Like - 16h
Like - 14h A Stacy Sanders Burge 13. a Chris Resto à
Б Heath NaughTeeboy Tanner Dont be sad....i pursued them Like - 17h
when I ned iyoo not tie oiher way сола became ап (ЖШ Jeremiah Miller 11 Like - 12h
escort at 14 and loves it. Now at prefer to be a one man e
pig. | dont enjoy multiple partners any more. Like: 14h ы Б eves к Раш Winchester Five
Like - 7h Uter A Like - 12h LE

Daemon Nushi 7, some random in a toilet. He picked me up, split
me in 2 and held me close as he pounded my hole. Will never forget
him

Like - 15h

Steven Miller 26

Siler Wesley 9 and lov

Like - 14h

Patrick Eaton 11 yo, played with cousin same age

Like 14h

Michael Vinci 9...was molested by a 70 year old man!

A z

Like - 15h Like - 14h

Allen Ray Feeman | had to be about 15. us John Geraghty 12 ж Christopher Lonkey 7

Like - 15h Like - 11h Like - 8h 42:

Ricky A Lenart 22 David Mott 5 9D з M] Grover Tesser Christopher Lockey БЕНЕН
Like · 15h Like - 11h Like - 8h !

57

[4 Joey Spriggs Paul Winchester 5
Like - 6h

Anthony Payne 16
Like - 12h

Brian Petersen 29
Like - 12h

Paul Bryan 13
Like - 12h

Randy S. Kidwell 14. My brothers
От

Like - 11h

David Keith Duffey 14

Like - 15h

Larry Cotton Markee Kershner 8th grade
Like - 15h

Travis Finn 7
1

Like

6h

Grover Tesser Travis Finn hope itwas consensual. If it was

my hat is tipped to you buddy.
Like - 6h

Travis Finn Grover Tesser It was totally consensual and
started off as touching and progressed from there.

@ Grover Tesser David Мо

Like - 11h

Mark Orman 3rd grade

Like - 8h «2 5

a Grover Tesser Mark Orman m
Like - 8h

Like · 5h

However I Love it now !
Like · 4h

Grover Tesser Ron Boatriont [hope tnat it was consensual:
If so my hat is tipped off to you. | knew | was fascinated by
crotches at 3. Played with a couple of cousins at 6. Had my

first dick with cum at 9. High school boy. He turned me on to a
couple of his horny friends. Loved suckin their cocks.

Ron Boatwright Grover Tesser no it wasn't | was a baby.

©

1

? Michael Browne Young

Les Wright 8 from my cousinin the Army m

Like - 9h
Leston Buell 19 maybe? ғ

Like - 9h

David Douglas Smith 9
Like - 9h

Like 5h
Mark Andrew Priest 12 L2
e: Like - 5h
el Buddy Reeder 12 ru
Like - 5h
Q:

Like - 11h

Like - 10h

Michael Benjamin 12 or 13

Like - 10h

Frank Lopez About 6 or 7.
Like - 10h е :
Perry Hummer 12

Like · 7h

Rick Schneiter 15
Like - 7h

Ken Harrison 12

1
Like - 6h

Aurthur King 12

1
Like - 6h

Q'

ізі Carlos Р Glinzman-Murphy 9 or 10

Like - 3h

О:

Grover Tesser Travis Finn

| put
out signals and innuendo. Sure they were older. But nobody
was lurking in the bushes offering me candy to suck their
cocks.

Grover Tesser Ron Boatwright bless you buddy. Thank my.
оџ are a survivor. Men and cocks and cum, not to
mention balls and an ass to eat are the best things in life.
Maybe too much to question but | am interested. Do you feel
your very early experience swayed your sexuality? | was born

Mark Jump Sr 8 , old man neighbor made me kiss him and fondle
him, but loved playing with my same age friends, then in my teens
my older brother friends would come over while my brother was
away and lay naked on me humping and a lot of frottage, | loved it,
then | tried to live a straight life until my early fifties started with cock
again at 51, now I'm 61 and still can't get enough, want it all the
time

едо:

gay. Have never been with a woman. Lucky to have had the

most understanding parents in the world from the get-go. Like - 5h

ғ.

Like - 3h
Like - 3h

Doug Reiss Depends on what way.... first time someone had mine
(in a way) | was 14. Went home with someone at age 18. Got very

Larry Laura Grey Dees 7 and I'd do it all over again

«25:

Alex Vázquez 17

От

Joe Robinson 15

Like - 2h
Like - 1h

Gregory D. Felten 12

Like - 4h Sick afterwards (and | know why).
œ 1Reply Ll Chadley Dunn 13. It was awesome. He got me into my fetish for Like - 2h o:
ma guys with a hairy ass and uncut dick
7 MEL беле аз” Like - 3h еэ m Jerry McCumber 177i think! Hot contractor Ryan Logan 12
1
te m % 1Repy Like - 2h o Like-th 4!
5% Robert Buhrow ШЕ William Bonilla | һауе my own dick since birth A Lance Hilmer 14 Michael J Keith 14
Like - 4h Like - 3h O2: Like - 2h Like - 1h :
N Nelson Gonzalez About 8 % 3Replies E Matt Wesson About 12 Rich IE 14
Like - 4h ө?ғ: i ;
Eddie Pabon 5 Like · 1h Like - 1h
œ 1Reply Like - 3h Оз >
= ШЕ Alex MacLeod Matt Wesson 1291 Е meta
КВ Егіс Nudelman too old * 3Replies Like - 28m Like - 52m @DO 4
- ike m
Like - 3h - Edited 68 Levi Scott LeMay Way too young & no regrets 7 "
5 Rick AndRock | was 10 and my friend was 11. | was his first and he
Ф 2Replies Like - 2h was my first. We messed around for a couple years just playing but
А this опе night we took it all the way and yes | felt him when he came.
Charles Hutton 20 jim Todd Michael Kepus 16 He said he felt me too. We messed around for about 10 more years
рит — then we lost touch
ike
Like - 1h - Edited Osa’

Michael Petersen 17

Like - 2h Ф

Like - 1h

Jim Williams 16 first | sucked him then he bent me over and shoved

itin. He was 44
Оза:

Brett James Still Waiting €5 29

Like · 27m
Like · 52m

Manuel Pico 16

Р а

ы Rod Раш Andrés Jim, | was 16 when | got involved with а 36
year old. Knocked on his door, he invited me in. One thing led
to another and | ended up being passed around to three
others through the evening.

Like - 17m

Skip VandeLinde 5

42:

Like - 51m

о:

Like - 46m

Like · 26m

Ruby Morales 12, with my neighbor and best friend who was also
12 for a summer then we moved and | did not have anything until |
bottomed at 18. That was awesome. Haven't had any since. | am bi
and happily married to a woman.

Оз:

Frank Abbott 18 year old
Like - 25m

В Jason Clark Hmmm. Consenusally about 12. Mileages proably 4 or
5

Manuel Pico | let them Catch me
Os:

Like - 41m
Like - 25m

Luis Hernandez 5
3 Grover Tesser Manuel Pico well somet]

something. GRIN
Like - 18m

Like - 40m
Fernando Roura | was underage

LE
58 d

Tim J. Stieg About 13 maybe. Maybe 14
Like - 17m

Like - 35m

58

What is Comet Pingpong known for?
Why is the Rom-show for “All Ages”?

P sashalordpresents joshuaryanv
Comet Ping Pong »

P UJ@L
“Т

Т! i

Comet Ping Pong

\sasHa e] à
| PRESENTS fÑ

oct ober 28, 2016
canes ping pong

25 likes

;astanya ,% $ iS

59

| FOLLOW

Why is the symbol for pedophilia in the
shape of a worm?

It gets worse.

5. POLITICS
аар

How often should humans be treated for parasites? PARASITE-MARE Surgeons pull dozens

[at least once per year] day
How often are Americans treated for parasites? of ‘WRITHING’ parasitic worms from

[Never] boy’s tummy after he became
constipated

Gemma Mullin
10 Jun 2019, 15:47 | Updated: 10 Jun 2019, 17:33

American pets are given access to low-cost, over-the- с а
counter anti-parasite medication that has no known

side-effects in humans. A FOUR-year-old boy had dozens of parasitic worms removed from his

Yet American humans are not put on regular parasite- | P99v after he complained of feeling constipated.

treatment schedules. Stomach-churning images from the operating room showed a metal bowl
filled with the "writhing" creatures.

Reconcile.

Can parasites lobotomize their host?
[poor memory and thinking skills]

Parasite >>> Infected Host >>> Poor Critical Thinking
Poor Critical Thinking + Mass Media = Control Voters

The 'bundle of live worms' in a metal bowl after being removed from the boy's

What is the [real] reason Americans do not have small intestine Credit: BMC
recommended parasite-treatment schedules?

The four-year-old boy lying on the operating table during surgery Credit: BMC

'Bundles of worms'

The team, led by Dr Valirie Ndip Agbor, extracted the "bundles of live
worms" through a small incision in the boy's intestine.

Doctors said if the worms had not been removed they could have led to
malnutrition, physical growth problems and poor memory and thinking

It gets worse. skills.

He hadn't been "dewormed" since birth - 55:619215 ЕЗ
to clear off adult worms and their eggs from the bowel.

60

Can parasites mind control their hosts?

Parasites Practicing Mind Control

AUG. 28, 2014
An unassuming single-celled

organism called Toxoplasma gondii is
one of the most successful parasites
on Earth, infecting an estimated 11
= percent of Americans and perhaps
Carl Zimmer half of all people worldwide. It’s just eU
РНИ? as prevalent in many other species of
mammals and birds. In a recent study
in Ohio, scientists found the parasite
in three-quarters of the white-tailed

%
*
deer they studied. »

One reason for Toxoplasma's success

is its ability to manipulate its hosts.

The parasite can influence their

behavior, so much so that hosts can a
put themselves at risk of death.

Scientists first discovered this strange A microscopic cyst in the brain of a mouse containing thousands of Toxoplasma gondii
mind control in the 1990s, but it’s parasites. New research has found that the parasite is able to exert a form of mind control by
turning its host's genes on and off. Jitenc S.D.A

F«Fnrnm

H

been hard to figure out how they

manage it. Now a new study suggests
that Toxoplasma can turn its host's

enes on and off — and it's possible other parasites use this strategy,

The Atlantic

SCIENCE

Neuro-parasitology is an emerging E ^ Я Parasites Can Mind-

branch of science that deals with A е : Қ
parasites that can control the nervous er x» "Re ; Control Animals

system of the host. ... Іп some of the most : 4 САТУ АУМ 22 Without Infecting
fascinating manipulations, the parasite Ж, 3 АЛЫР Them
taps into the host brain neuronal circuities ib қ

to manipulate hosts cognitive functions. ч 2 : In 2018, everything is a metaphor.

1 May 2018 By Ed Yong

® https://wwwrontiersin.org » full
Mind Control: How Parasites
Manipulate Cognitive Functions in ...

Can humans be controlled by a parasite?

A kingfisher catching a stickleback (Nigel

"We're never ever going to be allowed to do
that with humans." In a lab setting, Toxoplasma
also binds to dopamine receptors, which are the
brain's reward centers. "It's quite possible and
plausible that if you have an agent affecting
dopamine, it could influence people's behaviors,"

Adamo says. 7Dsg 2012

61

https://www.discovermagazine.com/planet-earth/meet-the-parasites-that-control-human-brains

Meet the Parasites That Control Human Brains

Toxoplasma, brain-infecting amoebas, rabies and more.

By Ben Thomas | Oct 29, 2015 9:00 AM

News > Medscape Medical News

Common Parasite Now Tied to Impaired
Cognitive Function

Batya Swift Yasgur, MA, LSW
. July 22, 2021

The macabre world of mind-controlling parasites
roscience Articos | August 25, 2019

Summary: Understanding how parasites ‘hack’ the brains of their hosts may provide new

insights into decision making and behavior. Log In

Source: Frontiers Username

Imagine a parasite that makes an animal change its habits, guard the parasite’s
offspring or even commit suicide. While mind-control may sound like something out of Password
a science fiction movie, the phenomenon is very real — and has spawned a new field,

neuro-parasitology. As outlined in an article published in Frontiers in Psychology,

Remember Me

understanding how parasites “hack” their host's nervous system to achieve a particular

goal could provide new insights into how animals control their own behavior and make

Create

decisions.

Mind Control: How Parasites Manipulate
Cognitive Functions in Their Insect Hosts

Wi Frederic Libersat“, F Maayan Kaiser and E. Stav Emanuel

Department of Life Sciences and Zlotowski Center for Neurosciences, Ben-Gurion University of the Negev, Beer-Sheva,

Israel

Neuro-parasitology is an emerging branch of science that deals with parasites that can control
the nervous system of the host. It offers the possibility of discovering how one species (the
parasite) modifies a particular neural network, and thus particular behaviors, of another

At least now you know what he is talking about: LINK

62

Are parasites used to mind control high-profile targets? [political power, financial power, military power]
Would this behavior be considered ‘normal’ or ‘hacked’? LINK1 LINK2

Are high-profile targets sent to special luncheons and dinners?

What is put into the food?
Who is spikethechef?

What is Comet Pizza?

Who is this?

Are ‘hacked’ targets easy to control?
What are (((handlers)))?

Parasite hacks and then lobotomizes host.
Host's power transfers to (((Handlers))).
Vote Red? Vote Blue?

Either way, Power >>> (((Handlers)))

Are mentally ill individuals suitable for public service?
Are mentally ill individuals suitable for leadership roles?
Are mentally ill individuals suitable for promotion in the military?

Mental illness or brain-parasite?

What if he/she/they/them are purposely infected due to position of power?
What if he/she/they/them are promoted and given more power because they are infected?

It gets worse.

64

Can parasites take complete control over a host? LINK

Can controlled hosts infiltrate into high-level government organizations?

Once in position, can controlled hosts pass legislation which supports the spread of parasites?

Would this result in directing scientific funding away from parasite treatments?

Would this result in outlawing Fenbendazole while also mandating Glyphosate?

Can these high-level controlled hosts work to include Polysorbate-80 and aluminum in vaccines?

Can these high-level controlled hosts work to mandate these vaccines?

What happens to the career of medical doctors who suggests something that goes against recommendations
of the WHO or CDC? LINK

Why make every effort to ensure that humans are infected by parasites?
[the end goal of a parasite is not to kill the host, but to spread more parasites]

When a person of influence does something which goes against common sense, we assume he has been

bribed, black-mailed, threatened...
[Wrong] [Wrong] [Wrong]

He has been infected.

Is a controlled host still aware of the actions he performs?

Does a controlled host still feel remorse and guilt, but is unable to stop himself from obeying the parasite?
Does this cause a controlled host to wish he could die, but the host is still unable to kill himself? [R9.6]
What is the [real] reason suicide rates are so high in the infected?

Who is this?

What were his beliefs in 1960?

His beliefs in 1961?

In 1962?

1963?

1964?

1965?

1966?

[MOST loyal adherent]

Did his beliefs suddenly change in 1967?
Did he just suddenly decide to 'change his mind'?
OR was his mind changed for him?

Are parasites biological?

What are biological weapons?

65

What is biowarfare?

Are parasites biological?

Can parasites be used as weapons?
Can parasites mind control their hosts?

US Commerce Dept says China has brain-control
weaponry

Academy of Military Medical Sciences lands on the Entity List for its role, along with 36 other orgs
Laura Dobberstein Fri 17 Dec 2021 // 07:02 UTC

5402 The USA has added another 37 organizations - 34 of them from China — to its
list of businesses with which US interests can't interact without a license, with
a» 12 of them earning their places for developing "mind control weapons."

As usual, the newly listed organisations earned their place on the grounds
their activities represent a threat to national security. Less usually, this batch
sees plenty barred for bodgy biotech.

Did the US have a biolab in Lyme, Connecticut, which specialized in tick-borne illnesses?
How did Lyme disease get its name?

What insect causes Lyme disease?

Why did the CDC cover up Lyme disease for 45 years?

Is Lyme disease caused by a parasite [bioweapon]?

Have US operatives worked to cover up the cause of other parasitic diseases?

Is Alzheimer’s caused by a parasite [bioweapon]?

'Two decades of Alzheimer's research was based on
deliberate fraud by 2 scientists that has cost billions
of dollars and millions of lives

Recommended

Countless lives destroyed, billions of dollars lost, so many families torn apart...
...and all just to protect their precious bioweapons.

66

To protect their precious bioweapons, would they suppress information about other treatments?
What is Covid19?

What is hydroxychloroquine [HCQ]?

15 НСО effective against Covid19?

15 НСО effective against parasites?

Did a high-level political figure [45] recently suggest mass-use of HCQ?

15 НСО safe to use in the short-term to treat illness?

Is HCQ even safe to use in the long-term?

@ lupus.org/news/safety-of-long-term-use-of-hydroxychloroquine-therapy-further-verified-for-people-with-lupus

LU 2US Understanding Lupus Living '

FOUNDATION OF AMERICA

News
February 14, 2019

Safety of Long term use of
Hydroxychloroquine Therapy Further

Verified for People with Lupus

Hydroxychloroquine (Plaquenil®) was approved by the Food and Drug Administration for symptoms
of lupus. The greatest concern people with lupus have when taking hydroxychloroquine is related to
vision and an increase in risk for retinal damage. A new investigation analyzed the retinal changes
over a five-year period in people with lupus and did not find clinically relevant retinal changes in the
group. The study concludes that hydroxychloroquine therapy is use at doses «5
mg/kg/day. Learn about how lupus affects the eyes and hydroxychloroquine.

What effect might a massive application of HCQ have on a population being manipulated by parasites?
Would NPCs begin to heal?

Would NPCS begin to regain use of logic and reasoning?

Death knell to (((those in control)))?

How might (((those in control))) react to such a situation? DJ Patriot

Billionaire pharmaceutical company founder Barry
and his wife Honey Sherman were murdered in their

Craig "Sawman" Sawyer ™ ind Toronto home on Dec. 15, 2017.
@CraigRSawyer They owned Apotex, a manufacturer of generic
drugs, specifically HYDROXYCHLOROQUINE.

‘Unexplained’ Explosion Destroys World's Second They manufactured the drug.
Largest Hydroxychloroquine Raw Material Factory = =

~\ DrBill
@DrBill_ MD.

| am a licensed physician in
Utah. | tried to prescribe

P» hydroxychloroquine but the
| | l pharmacist said the state had

taken over the distribution of the
“Unexplained” Explosion Destroys World's Second Largest Hydroxychloroquine R... "A
Well, 2020 is refusing to go out without a bang. Literally. An "unexplained" drug. Even though I'm licensed, |

explosion just destroyed the world's second largest hydroxychloroquine raw ... cannot prescribe it. This is
& welovetrump.com
WRONG!

2:04 PM . Dec 23, 2020 - Twitter for iPh , Р
ИЧЕ ii i ы 1:10 PM - 4/5/20 - Twitter for iPhone

Did hydroxychloroquine suddenly become a "life threatening" drug and its use must be immediately
banned?

So many different articles written by so many different authors, yet such similar wording:

The largest-yet survey of using a Trump-touted z Study find EECA om
a malaria drug t ес as coronavirus cure

(f) Oregonian

in COVID-19 patients

treated with malaria drug hydroxychloroquine:
study
Chicago Tribune | 2 hours ago

ars

he malaria drug wi

ted by President Donald
howed no benefit in а

A malaria dr

no benefit

'ans hospitals. The: he

en hydroxychloroquine v

reported. The nationw

More deaths, no benefitffrom malaria drug in VA
virus study

AP Associated Press | 7h а

study was not a ri

Delayed death certificates interrupting municipal
benefits, union leaders say

4 More Deaths, No Benefit
ату Beast | 5 hours ago

obtain death

'ontinued health

ident Donald Trump for
ved no benefit in a large

'ans hospitals. There

A malaria drug w

ificates that enable the
ge and other benefits, асс
о death certificates right

treating the new coronav ho Yem to secure

analy f its use in U.S. v

more deaths

COVID-19 treatment hydroxychloroquine
showed{no benefi: more deathdin МА virus
study

Ш Fox News | 2 no

Malaria
arge study c

d

ury at a very high

can

Study findq more deaths, no benefitffrom

malaria drug touted by President Trump
T кноу 14

wing
по benefits to patients with

Hydroxychloroquine test
in VA study
ЕШ Merc g

ed no benefit in a
spitals

an А malaria drug

say

ous experiment

NEW: Study shows[no benefitfrom drug touted

by Trump in virus fight
El Агата Jou ituti

Study finds|more coronavirus deaths, no benefit
from malaria drug touted by Trump

A malaria dr dent Donald Trump for
treating th ed no benefit in a
a E: 1 Philadelphia 1
analysis of it hospitals. There Е

А malaria dr t by Pr nt Donald Tr г
more death: ia dru by President D d Trump fo

standard care.

^ ү туге қ TR
Study shows[more deaths, no benefit]ffrom Coronavirus updates ШЕ

malaria drug touted by Trump from NBC News Raleigh №
ФА NBC News| 2h

hydroxychloroquine v

treating

analysis of its

more deaths amon

a rigorous experiment.

Drug championed by Trump for coronavirus
awaiting validation x Я
37 : oe
‹ ynoa d treatment
s y - An ana s

Talking Points Memo

A malaria drug v
g the ni

udy "
Coronavirus study]More deaths, по benefitffrom

ited by p

out an antibiotic for COVID-19.

More deaths, no benefitffrom malaria drug
No benefit, more deaths]Hydroxychloroquine Touted by Trump, coronavirus study finds

lops in VÀ hospitals study T Tampa Bay Times | 1 hou

Ш washington 7 A malaria drug үйде

more deaths amc
standard care, re:

But witi

368 pati

not a rigorous experiment. | More deaths, no Бепей тот malaria drug
hydroxychloroquine in VA coronavirus study
5

% The Boston е |5

Veterans With COVID-19 Given Trump-Touted
Hydroxychloroquine Showed|No Beneta] Study

Finds

hloroquine ve:

n a retrospective study. which has not yet b

mined patient

Hydroxychloroguine as treatment for COVID-19
showqno benefit and more dearhs[in VA study

W MarketWatch | 5

А malaria drug resident Donald Tru

ias

" President Ti
AVA coronavirus study finds Қ” IU potential breakthro

hydroxychloroquine results i ^ і j analysis of its us:

d no benefit in a

treating the n

Salt Lake Tribune | 2 ho

by President Donald Trump for
ed no benefit in a large

Thi

A malaria

treating the virus sh

analysis of its и
more deaths a

‘Ivermectin: FDA approved drug with over д billion doses administered
worldwide, named on W.H.0's List of Essential Medicines and won their

Why did the media never report on the following: LINK inventors the Nobel Prize in Medicine in 2015"
(((Who))) controls the media?

Was there are similar response to Ivermectin?

Why did Mass Media run a smear campaign to convince the
public that Ivermectin was just horse-paste?

Why did the media never report on the following: LINK
((Who))) [really] controls the media?

r-
hOrSe DeWoRMEr

ана

It gets worse.
68

What did the CIA mean by this?

"Telergons play an important role in the interrelationships of the
Organism with its environment, since by means of them the animal can exert
diverse actions on other organisms which are located within its Immediate
surroundings and which are involved in the combination of its conditions
of existence. One telergon serves the animal as protection against enemies,
another -- for immobilizing prey, a = -- for oe nut

1%) » 8

Sanitized - Approved For Release : CIA-RDP82-00141R000100290001-2

The article points out that the term in question is purely physio-
logical and encompasses substances of very diverse chemical composition;
telergons can be proteins, steroids, alcohols, organic acids, etc. Gen-
erally, Kirshenblat subdivides telergons into the following categories:

A. Honotelergons -- substances which act on other members of the
same species

1. Gonofions, which cause formation of or changes in sex charac-
teristics

2. Gamofions, which stimulate maturation of sex glands and re-
productive processes

3. Epagons which attract other members of the same species

-- substances which act on animals of other
species

Progaptouns, which immobilize or kill prey
Aminons, which protect animals from enemies

Likhneumons, which are elaborated by Myrmecophils and termi-
ophis and expectorated by ants or termites, on which they
e-sġimulating or narcotic effect

Google Scholar хепадопѕ
Articles

Any time Your search - xenagons - did not match any articles.
Since 2021

Since 2020 Suggestions:

Since 2017

Make sure all words are spelled correctly.
Custom range...

Try different keywords.

Try more general keywords.

Sort by relevance Try your query on the entire web
Sort by date

Why are they covering up information about xenagons and parasites?

[Maintain control by any means necessary]

69

Can bioweapons be used to perform covert political assassinations with plausible deniability?
Are political assassinations performed using 'cancer'?

Who is Bill Oxley?

Or are political assassinations performed using ‘parasites that cause cancer’?

@ researchgate.net/publication/7889939 Pathogenic significance of a-N-acetylgalactosaminidase activity found in the hemagglutinin of influenza virus

Is a-N-acetylgalactosaminidase the key to curing cancer? A mini-review and hypothesis

Article Nov 2017 - J BUON

@ Ehsan Saburi - € Jalil Tavakkol Afshari - Sajjad Biglari . Yousef Mortazavi

View Show abstract

... Evidence also shows changes in the GalNAc components of the extracellular matrix and extracellular membrane attachment component such as
integrins in cancer tissues or cells (16,17). These findings confirm that the presence of Nagalase in many pathogens such as bacteria, parasites and
viruses may be effective in their spreading in the body (15,18, 19). One of the most important role of Nagalase has been investigated in macrophage
suppression (20). ...

Does aerobic glycolysis of the parasites deplete nearby host cells of oxygen?

Does oxygen depletion result in localized cells being forced into the fermentation-mode of ATP generation?
If those cells are locked into fermentation-mode of ATP generation, would this result in a rapidly growing
tumor which would soon be destroyed by the body's immune system?

What if the body's immune system is unable to detect the rapidly growing tumor?

What is Nagalase?

The so-called “Nagalase” is an endogenous enzyme that plays a role in sugar metabolism. The scientifically
correct name is “N-acetyl- Galactosaminidase". Nagalase can split off certain sugar molecules , namely N -
acetyl- galactosamine , from large molecules.

Specifically, Nagalase may split off the N- acetyl galactosamine sugar side chain from the so-called “vitamin D -
binding protein” (“DBP”).

DBP is found in serum and is also referred to as ^Gc-Protein".

Yamamoto and colleagues reported that tumors can produce Nagalase ( Yamamoto et al. 2008a , 2008b , 2008c ,
Reddi et al. , 2000). Moreover they reported that in tumor patients Nagalase serum levels mabe increased.

There is evidence that the Nagalase produced by tumors has an “immuno- suppressive” effect: It is thought that
the Nagalse-mediated immune-suppression in cancer patients contributes to the growth of the existing tumor and
the formation of metastases.

Do parasites produce Nagalase to hide from the body's immune system?

Does the immunosuppressive effect of Nagalase also prevent the body from locating and removing the
abnormally and rapidly growing cells which have been locked into fermentation-mode by parasites which are
consuming all localized sugars?

Parasites >>> Force Cells into Fermentation >>> Results in rapidly dividing cells >>> Nagalase >>> Cancer

70

Stages of Parasite infection:

Parasites infect local tissues [Stage 1}

Rapid Parasite growth >>> Parasites burrow deeply into local tissues [Stage 2]

Parasites protect themselves by infecting/damaging lymph nodes [Stage 3]

Parasites get into blood stream and spread to other parts of body — metastaic [Stage 4]
No active parasites but inactive parasite larva which may activate years later [Remission]

What other common disease has 4 stages and a remission state? [Cancer]

Parasites >>> Consume local sugars
Lack of sugars >>> Force Cells into Fermentation-mode of ATP generation
Prolonged Fermentation-mode >>> Uncontrolled, rapid cell-division
Parasites release Nagalase to hide from Host’s immune system
Nagalase >>> Also hides local cells which are rapidly dividing

.. rapidly dividing

Do parasites cause cancer? LINK

Did a parasite cause your cancer?

18 June 2017

Four common cancers linked to infections

In a research study (Lancet Oncology May 2008) using IARC data, researchers found four common
infections linked to a large number of cancers: Human papillomaviruses (HPV), Helicobacter pylori,
and hepatitis B and C link to 1.9 million cases of cancer.

While the study reports that these infections are rarer in developed countries, air travel makes
everybody vulnerable. "Infections with certain viruses, bacteria and parasites are some of the
biggest and preventable causes of cancer worldwide," said Catherine de Martel and Martyn
Plummer, who led the study.

Cervical cancer accounted for about half of the infection-related cancers that occurred in women,
and liver and stomach cancers accounted for more than 80 per cent of the cases in men.

The term 'parasites' can include parasites themselves (these do not have to be a meter long but
can be microbial), viruses, bacteria and yeasts. About 17 per cent of cancers are known to be
caused by parasites, the real figure could be even higher, while in some cancers, yeasts are

recognized to be a potential problem during modern orthodox treatments.

nonymous (ID: CESAM) = 08/26/22(Fri)23:40:14 No.392743850 »

22392742877
It's more the "by products" of infestation that the body can't isolate, but yes cancer is parasites.

Cleveland Clinic is about the only place in the US that treats parasites. They used to have an article on their website about parasites and breast cancer. They took it down.
They studied my friend's case and even came out to visit her and talk to her doctors.

Woman's brain tumor turns out to be parasite
growing in her head

A parasite in the brain sounds like the plot of a horror movie, but it's a preventable infection from

tapeworm that can be found in pork. Reminder: are parasites sexually transmitted?

Define 'routine close contact'?
Oral Sex and the
Alarming Rise of HPV-

Related Throat Cancer in
Men

By 2020, the rates of HPV-related
oropharyngeal cancer are expected to

surpass those of cervical cancer. So
why aren't young men getting
vaccinated?

By Kimberly Lawson

A 3D imaging "fly through" shows the location of Rachel Palma's brain lesion. қайнатады We

May 29, 2019, 11:48 AM EDT / Source: TODAY

By A. Pawlowski

Rachel Palma’s symptoms were strange and disturbing: She was
having hallucinations, insomnia and “horrific nightmares.” Her right

hand would suddenly give way and she’d drop things. She was

having trouble finding the right words and made alarming phone

sofisrael.com/f

ungus is telltale cancer sign,
possibly screenable by blood
test: Israel-US study

Many tumors are teeming with fungi that shed DNA into blood, and
researchers say blood analysis could offer treasure trove of information to
detect and to shape treatment

calls to her family that she didn't remember.

“My episodes were getting more and more bizarre ШВВВРА
lives in Middletown, New York, told TODAY. “There were days that I

didn’t know where I was.”

a

cdc.gov/media/releases/2015/p1104-parasite-tumors.html

Hunting for fungus in the human body may offer a brand-new method for
early detection of cancer, Israeli scientists suggest in new peer-reviewed
research.

Scientists at the Centers for Disease Control and Prevention have
discovered cancer cells originating in a common tapeworm may

take root in people with weakened immune systems, causing
cancer-like tumors. It is the first known case of a person becoming

Working with colleagues in the US, they studied tumors from 17,000 cancer
patients to document, for the first time, which fungi live in the tissue.

ill from cancer cells that arose in a parasite - in this case,
Hymenolepis nana, the dwarf tapeworm.

There has been very limited research until now on fungi in tumors, and
scientists had assumed that its occurrence was rare. "We were surprised to
find that it's actually more common to find tumors with fungi than

without,” said Dr. Ilana Livyatan of the Weizmann Institute of Science.

The report, in the Nov. 5 issue of the New England Journal of
Medicine, raises concern that other similar cases, if they occur, may

be misdiagnosed as human cancer - especially in less developed countries where this tapeworm and
immune-system-suppressing illnesses like HIV are widespread.

"We were amazed when we found this new type of disease - tapeworms growing inside a person
essentially getting cancer that spreads to the person, causing tumors," said Atis Muehlenbachs, M.D.,
Ph.D., staff pathologist in CDC's Infectious Diseases Pathology Branch (IDPB) and lead author of the
study. "We think this type of event is rare. However, this tapeworm is found worldwide and millions of
people globally suffer from conditions like HIV that weaken their immune system. So there may be
more cases that are unrecognized. It's definitely an area that deserves more study."

72

Is it statistically significant that 100% of lung cancer patients are associated with parasites?

Ш ncbi.nim.nih.gov/pmc/articles/PMC6536861/

High frequency of infection oflung cancer patients with the parasite Toxoplasma
gondii

Jaroslav Bajnok,! Muyassar Tarabulsi,! Helen Carlin, Kevin Bown,’ Thomas Southworth,? Josiah Dungwa,?
Dave Singh,? Zhao-Rong Lun,'3 Lucy Smyth, and Geoff Ніде!

к Author information > Article notes > Copyright and License information Disclaimer

Methods

Lung tissue samples were taken from patients undergoing lung resection surgery (n=72) for suspected
lung cancer (infection prevalence 100% (95% CI: 93.9-100%)). All 72 participants were confirmed as
having lung cancer following subsequent diagnostic tests. In addition, bronchial biopsy samples were
collected from non-lung cancer healthy control subjects (n=10). Samples were tested for T. gondii
using PCR amplification of T. gondii specific gene markers and T. gondii specific
immunohistochemistry.

Results

EPA ee lem oem oases! with T. gondii (prevalence 100% (95% CI: 93.9-100%)). Of

which, 95.8% (n=69) of patients showed evidence of active parasite stages. Infection prevalence in the
controls (10%) was significantly lower (p<0.0001).

@ cancer.org/healthy/cancer-causes/infectious-agents/infections-that-can-lead-to-cancer/parasites.html

Parasites that Can Lead to Пр
Cancer

A Society

Certain parasitic worms that can live inside the human body can also raise the risk of
developing some kinds of cancer. These organisms are not found in the United States, but

they can be a concern for people who live in or travel to other parts of the world.

Opisthorchis viverrini and Clonorchis sinensis are liver flukes (a type of flatworm) that have
been linked to increased risk of developing cancer of the bile ducts. The bile ducts are tubes

that connect the liver to the intestines. These infections come from eating raw or

undercooked freshwater fish. They occur mostly in East Asia and are rare in other parts of the

world. Fungi grow inside cancerous tumors,
scientists discover

Schistosoma haematobium is a parasite found in the water of some countries in the Middle © Live Science - 5h Q
East, Africa, and Asia. Infection with this parasite (an illness called schistosomiasis) has been

linked to bladder cancer. Possible links to other types of cancer are now being studied as well.

73

If parasites cause cancer, would anti-parasite medications be effective against cancer? LINK

ё pubmed.ncbi.nlm.nih.gov/31375107/

Ivermectin inhibits canine mammary tumor growth
by regulating cell cycle progression and WNT
signaling

1 2

Hongxiu Diao ', Nan Cheng |, Ying Zhao 1, Huihao Хи ', Haodi Dong ', Douglas Н Thamm

Di Zhang 3, Degui Lin 4

Affiliations + expand
PMID: 31375107 PMCID: PMC6679554 DOI: 10.1186/512917-019-2026-2
Free PMC article

Abstract

Background: Mammary gland tumor is the most common spontaneous tumor in intact female dogs,
and its poor prognosis remains a clinical challenge. Ivermectin, a well-known anti-parasitic agent, has
been implicated as a potential anticancer agent in various types of human cancer. However, there are
no reports evaluating the antitumor effects of ivermectin in canine mammary tumor. Here, we
investigated whether ivermectin was able to inhibit canine mammary tumor development and
explored the related mechanisms.

Results: Ivermectin inhibited the growth of canine mammary tumor cell lines іп a dose- and time-
dependent manner. The antitumor effects induced by ivermectin were associated with cell cycle arrest
at G1 phase via down-regulation of CDK4 and cyclin D1 expression, with no significant induction of
apoptosis. Furthermore, significantly reduced B-catenin nuclear translocation was observed after
treatment with ivermectin, resulting in the inactivation of WNT signaling. Consistent with the results in
vitro, a significant suppression of tumor growth by ivermectin was observed in canine mammary
tumor xenografts.

Conclusion: Ivermectin, as a promising anti-cancer agent, inhibits the growth of canine mammary

tumor by regulating cell cycle progression and WNT signaling.
The Benzimidazole-Based Anthelmintic
Parbendazole: A Repurposed Drug Candidate That
Synergizes with Gemcitabine in Pancreatic Cancer

/?022c
28386

ё pubmed.ncbi.nlm.nih.gov/ 621/
Rosalba Florio !, Serena Veschi 1, Viviana di Giacomo 1, Sara Pagotto 2,35 Simone Carradori 1"),
Fabio Verginelli 132 Roberto Cirilli *, Adriano Casulli 56, Antonino Grassadonia 22,
> Mol Med. 2017 Арг;23:50-56. doi: 10.2119/molmed.2017.00011. Epub 2017 Apr 5. Nicola Tinari 23, Amelia Cataldi 1, Rosa Amoroso 1Ф, Alessandro Cama 1/3" апа
Laura De Lellis 1
1 Department of Pharmacy 'Annunzio University of Chieti-Pescara, 66100 Chieti, Italy;
rosalba.florio@unich.it (R.F.); veschi@unich.it ( iana.digiacomo@unich. it (V.d.G.);

Repurposing Mebendazole as a Replacement for
Vincristine for the Treatment of Brain Tumors e cement sis amelia.cataldi&unich.it (A.C.); rosa.amoroso&unich.it (R.A.);

Department of Medical, Oral and Biotechnological Sciences, G. d' Annunzio University of Chieti-Pescara,
66100 Chieti, Italy; sara.pagotto@unich .it (S.P); antonino.grassadonia@unich it (A.G.);
nicola.tinari@unich.it (N.T.)
Center for Advanced Studies and Technology (CAST), University “С. d'Annunzio" of Chieti-Pescara,
66100 Chieti, Italy
Centro nazionale per il controllo e la valutazione dei farmaci, Istituto Superiore di Sanità, 00161 Rome, Italy;
К roberto.cirilli@iss.it
Affiliations + expand 5 WHO Collaborating Centre for the Epidemiology, Detection and Control of Cystic and Alveolar
PMID: 28386621 PMCID: PMC5403762 DOI: 10.2119/molmed.2017.00011 Echinococcosis fn Animals and Humans), Istituto Superiore di Sanità (ISS), 00161 Rome, Italy;
adriano.casulli@iss.it
Free PMC article European Union Reference Laboratory for Parasites, Istituto Superiore di Sanità (ISS), 00161 Rome, Italy
Correspondence: simone.carradori@uni alessandro.cama@unich.it (A.C.);
Tel.: +39-0871-3554583 (5.С.); +39-0871- 559 (А.С.)

1, Caitlin Powell '

154

Michelle De Witt 1, Alexander Gamble 2, Derek Hanson 2, Daniel Markowitz
Saleh Al Dimassi 1, Mark Atlas 3 4, John Boockvar 1 2 ^, Rosamaria Ruggieri

24

Marc Symons ! 2

Abstract Received: 26 November 2019; Accepted: 14 December 2019; Published: 17 December 2019 е, лы

The microtubule inhibitor vincristine is currently used to treat a variety of brain tumors, including low-
grade glioma and anaplastic oligodendroglioma. Vincristine, however, does not penetrate well into
brain tumor tissue, and moreover, it displays dose-limiting toxicities, including peripheral neuropathy.
Mebendazole, a Food and Drug Administration-approved anthelmintic drug with a favorable safety
profile, has recently been shown to display strong therapeutic efficacy in animal models of both
glioma and medulloblastoma. Importantly, appropriate formulations of mebendazole yield
therapeutically effective concentrations in the brain. Mebendazole has been shown to inhibit
microtubule formation, but it is not known whether its potency against tumor cells is mediated by this
inhibitory effect. To investigate this, we examined the effects of mebendazole on GL261 glioblastoma
cell viability, microtubule polymerization and metaphase arrest, and found that the effective
concentrations to inhibit these functions are very similar. In addition, using mebendazole as a seed for
the National Cancer Institute (NCI) COMPARE program revealed that the top-scoring drugs were
highly enriched in microtubule-targeting drugs. Taken together, these results indicate that the cell
toxicity of mebendazole is indeed caused by inhibiting microtubule formation. We also compared the
therapeutic efficacy of mebendazole and vincristine against GL261 orthotopic tumors. We found that

mebendazole showed a significant increase in animal survival time, whereas vincristine, even at a dose

close to its maximum tolerated dose, failed to show any efficacy. In conclusion Т 3757177

upport the clinical use of mebendazole as a replacement for vincristine for the treatment of brain

74

Q & pubmed.ncbi.nlm.nih.gov/31181622/

Benzimidazoles Downregulate Mdm2 and MdmX and
Activate p53 in MdmX Overexpressing Tumor Cells

Zuzana Mrkvová !, Stjepan Uldrijan 2 3 Antonio Pombinho *, Petr Bartůněk 5, Iva Slaninová 6

Affiliations + expand
PMID: 31181622 PMCID: PMC6600429 DOI: 10.3390/molecules24112152
Free PMC article

Abstract

Tumor suppressor p53 is mutated in about 50% of cancers. Most malignant melanomas carry wild-
type p53, but p53 activity is often inhibited due to overexpression of its negative regulators Mdm2 or
MdmxX. We performed high throughput screening of 2448 compounds on A375 cells carrying p53
activity luciferase reporter construct to reveal compounds that promote p53 activity in melanoma.
Albendazole and fenbendazole, two approved and commonly used benzimidazole anthelmintics,
stimulated p53 activity and were selected for further studies. The protein levels of p53 and p21
increased upon the treatment with albendazole and fenbendazole, indicating activation of the p53-
p21 pathway, while the levels of Mdm2 апа МатХ decreased in melanoma and breast cancer cells
overexpressing these proteins. We also observed a reduction of cell viability and changes of cellular
morphology corresponding to mitotic catastrophe, i.e.. G2/M cell cycle arrest of large multinucleated
cells with disrupted microtubules. In summary, we established a new tool for testing the impact of
small molecule compounds on the activity of p53 and used it to identify the action of benzimidazoles
in melanoma cells. The drugs promoted the stability and transcriptional activity of wild-type p53 via
downregulation of its negative regulators Mdm2 and МатХ in cells overexpressing these proteins.
The results indicate the potential for repurposing the benzimidazole anthelmintics for the treatment
of cancers overexpressing p53 negative regulators.

Pharmacol Res. 2021 Jan; 163: 105207. PMCID: PMC7505114
Published online 2020 Sep 21. doi: 10.1016/j.phrs.2020.105207 PMID: 32971268

Ivermectin, a potential anticancer drug derived from an antiparasitic
drug

Mingyang Тапо,20.ї Xiaodong Hu, ^ Yi Wang, Xin Yao,24 Wei Zhang,2” Chenying Yu,2» Fuying Cheng,®>
Jiangyan 11,24 and Qiang Fang? 4e"

Am J Cancer Res. 2018; 8(2): 317-331. PMCID: PMC5835698
Published online 2018 Feb 1. PMID: 29511601

The multitargeted drug ivermectin: from an antiparasitic agent to a
repositioned cancer drug

Mandy Juarez, Alejandro Schcolnik-Cabrera,' and Alfonso Duefias-Gonzalez?

Ivermectin converts cold tumors hot and synergizes
with immune checkpoint blockade for treatment of
breast cancer

Dobrin Draganov, Zhen Han, Aamir Rana, Nitasha Bennett, Darrell J. Irvine & Peter P. Lee

npj Breast Cancer 7, Article number: 22 (2021) | Cite this article

Why are anti-parasitic purgatives such as Ayuahuasca or San Pendro effective against cancer and depression?
Do parasites cause depression?

Do parasites cause cancer?

What would happen to the symptoms if the cause is removed?

75

- е @ ourworldindata.org/cancer

Сапсег аны

by Max Roser and Hannah Ritchie

This article was first published in July 2015; updated in April 2018 with latest cancer data for the year 2017 - and revised

substantially in November 2019.

© Reuse ourworkfreely Cite this research

In 2017, 9.6 million people are estimated to have died from the various forms of cancer. Every sixth death
іп the world is due to cancer, making it the second leading cause of death - second only to cardiovascular
diseases.*

Cancer is the second leading cause of death in the world.
What is the first?

Are certain cardiovascular diseases caused by parasites?
What is Dirofilaria immitis?

-Heart Disease 23% of total deaths
-Cancer = 21% of total deaths

Both causes draw direct links to parasites.

Yet there is still no regular schedule for parasite treatment in humans.
No treatment, despite links to 44% of total deaths world-wide.

70,000 deaths EVERY DAY can be linked to parasites.

Still no treatment schedule.

More deaths every day than American soldiers died during the entire Vietnam War.
Still no treatment schedule.

If 70,000 lives could be saved every day with a $1/day parasite treatment, would the entire world be placed
onto a parasite-treatment schedule?

What if 99% of the world population was infected?

What if people discovered the information in this document?

Would the truth put 99% of people in the hospital? [142]

What effect would world-wide routine parasite treatments have?
[Host no longer transfers power to (((Handlers)))]

[Voters no longer easily swayed by Mass-media assets]

What would happen to (((their))) system of control?

[Maintain control by any means necessary]

What happens to those who discover evidence of this?

76

The world's top anti-virus microbiologists are being killed off. By 2005, 40 were dead. Today, over 100.
Many murdered, the rest died under very suspicious circumstances. It is known they were all working
on highly sensitive or government-funded research projects tied to bio-weapons and viral pandemics.

Are these silenced ‘whistleblowers’ who knew too much?
Why isn't the mainstream media reporting on this story?

Why do doctors who discover the link between parasites and cancer always commit suicide? LINK

[Maintain control by any means necessary]

77

Is there a link between parasites and viruses?
Why are antiparasitic medications also anti-viral?

а, о

А world of viruses nested within
parasites: Unraveling viral diversity
within parasitic flatworms

(Platyhelminthes)

West Nile virusXartificially coloured) can invade the central nervous system more easily in

the-presence of parasitic worms. Credit: Science VU, Visuals Unlimited/Science Photo

December 2021
DOI:10.1101/2021.12.15.472606

Abstract

Because parasites have an inextricable relationship with their host,
they have the potential to serve as viral reservoirs or facilitate virus
host-shifts. Yet, little is known about viruses infecting parasitic hosts
except for blood-feeding arthropods that are well-known vectors of
zoonotic viruses. Herein we uncover viruses of flatworms (Phylum
Platyhelminthes, group Neodermata) that specialize in parasitizing
vertebrates and their ancestral free-living relatives. We discovered
115 novel viral sequences, including 1 in Macrostomorpha, 5 in
Polycladida, 44 in Tricladida, 1 in Monogenea, 15 in Cestoda and 49
in Trematoda, through data mining. The majority of newly identified
viruses constitute novel families or genera. Phylogenetic analyses
show that the virome of flatworms changed dramatically during the
transition of Neodermatans to a parasitic lifestyle. Most
Neodermatan viruses seem to co-diversify with their host , with the
exception of rhabdoviruses which may switch host more often,
based on phylogenetic relationships. Neodermatan rhabodviruses
also have an ancestral position to vertebrate-associated viruses,
including Lyssaviruses, suggesting that vertebrate rhabdoviruses
emerged from a flatworm rhabdovirus in a parasitized host. This
study reveals an extensive diversity of viruses in Platyhelminthes
and highlights the need to evaluate the role of viral infection in
flatworm-associated diseases.

78

Do parasites build viruses?

(You): B-But if Parasites cause the
flu, where do Viruses come fro- The Parasite-Pill

Correspondingly, much attention has been paid to the “excretory-secretory” (ES) antigens of

helminths, a pragmatic approach to collect mixtures of released proteins that dates back over How PARASITES evade the
60 years [9]. Much more recently, of course, the application of genomics, transcriptomics and

mass spectrometry has transformed our understanding of these complex and heterogeneous | ттипе Syste m

preparations by defining the individual molecular components that parasites release to modify

their environment [2]. As discussed below, these products are not only proteins, but also

include glycans, lipids and nucleic acids, in particular miRNAs, as well as small molecules and

metabolites, and are released in a variety of “packages”, including lipid vesicles.
— ee Қыл АН Шаң

- Genetic material Nucleic Acids v
(ОМА ог RNA) miRNA wal

М Capsid — Protein [V] Typical Virus Makeup

<

Typically 50-250 nm in diameter ANY QU ESTIONS?

Link: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5008435/

Asexual reproduction in the intermediate host [ edit]

Inside host cells, the tachyzoites replicate inside specialized vacuoles (called the parasitophorous vacuoles) created during parasitic entry into the сей,25123-39
Tachyzoites multiply inside this vacuole via the bloodstream to all organs and tissues of the

body, inclüding the brain ^? ^"^

Tachyzoites: LINK

What are Exosomes? LINK

[cellular communication network]

Do parasites build viruses to hijack the host's communication network between cells?

By hijacking communications, can the parasite manipulate the host's cells into serving the parasite? LINK
Do viruses cause disease, or do parasites cause viruses?

Does a cough transmit infectious viruses or does it transmit infectious parasites which then produce viruses?
Are viruses a disease or a symptom?

Why are anti-parasite medications [really] considered to be anti-viral?

Do the anti-parasite medications cure the disease, and thereby also relieve the symptoms [viruses]?

What is Pleomorphism? LINK

Born out of healthy cells?
...Or unseen parasite larva hatching due to the newly created acidic environment?

79

O Anonymous (ID: 6ІШ ШЕТ) = 09/28/21(Тие)17:21:15 No.341303196 p> >>341303668 >>341303773 >>341304532

22341287338

No, parasites use hormones and various other chemicals to alter the host behavior. They get into your body but they don't get into your DNA.
m Anonymous (ID: 4GWMIESA») = 09/28/21(Tue)17:32:20 No.341304532 » >>341304963

22341303196

they use epigenetics, bro

Anonym (ID 8) = 09/28/21(Tue)17:35:35 No.341304963 >>341305834
File: BBF4CO5F- ТЕСВ4 AF15-8(...).jpg (192 KB, 1200x2029)
>>341304532

>they use epigenetics, bro
Interesting. How, exactly? You got any sauce?

CJ] Anonymous (ID: €GVAMIEBAD) == 09/28/21 (Tue)17:42:15 No.341305834 »

>>341304963
https://www.sciencedirect.com/science/article/abs/pii/S092544392 1001472

parasite pill makes too much sense.

Do parasites use viruses to manipulate a host’s DNA through epigenetics?

@ news-medical.net/news/20200825/Advances-in-Virus-Epigenetics.aspx

How can a virus use epigenetic cofactors to dysregulate
cellular pathways and help control its life cycle?

There has been growing evidence that viruses exploit epigenetic processes in order to
control their life cycles. The role epigenetics plays in the regulation of viral infections is not
yet fully elucidated and the epigenetic regulation of viral gene expression has only
recently begun to emerge. Epigenetic regulation during viral infections is usually
bidirectional.

Virus will use host cellular factors for transcription or replication and epigenetic cofactors

such as histone acetylases, deacetylases, methylases, and demethylases in the control of
its life cycle. Viral pathogens have been shown to epigenetically dysregulate cellular
pathways in order to optimize their own transcription or replication or evade the cells
innate immune response.

For many virus types, nuclear persistence is dependent on genome chromatisation, where
virus DNA associates with core histone proteins, forming episomes during latent infection.
Integrating viruses such as retroviruses and lentiviruses insert their DNA into host
genomes, facilitating histone associations so that the viral chromatin is then subject to
histone modifications. This viral epigenome, like the host cell machinery, has significant
impact on viral gene expression and replication.

80

Viruses of parasites as actors іп the parasite-host
relationship: A " ménage à trois"

Amaranta Gómez-Arreaza ! , Anne-Lise Haenni 2, Irene Dunia ?, Luisana Avilán 4

Affiliations 4- expand
PMID: 27876650 DOI: 10.1016/J.actatropica.2016.11.028

Abstract

The complex parasite-host relationship involves multiple mechanisms. Moreover, parasites infected by
viruses modify this relationship adding more complexity to the system that now comprises three
partners. Viruses infecting parasites were described several decades ago. However, until recently little
was known about the viruses involved and their impact on the resulting disease caused to the hosts.
To clarify this situation, we have concentrated on parasitic diseases caused to humans and on how
virus-infected parasites could alter the symptoms inflicted on the human host. It is clear that the
effect caused to the human host depends on the virus and on the parasite it has infected.
Consequently, the review is divided as follows: Viruses with a possible effect on the virulence of the
parasite. This section reviews pertinent articles showing that infection of parasites by viruses might
increase the detrimental effect of the tandem virus-parasite on the human host (hypervirulence) or
decrease virulence of the parasite (hypovirulence). Parasites as vectors affecting the transmission of
viruses, In some cases, the virus-infected parasite might facilitate the transfer of the virus to the
human host. Parasites harboring viruses with unidentified effects on their host. In spite of recently
renewed interest in parasites in connection with their viruses, there still remains a number of cases in
which the effect of the virus of a given parasite on the human host remains ambiguous. The triangular
relationship between the virus, the parasite and the host, and the modulation of the pathogenicity
and virulence of the parasites by viruses should be taken into account in the rationale of fighting
against parasites.

Once you understand that these "viruses" are fabricated mental constructs to explain away the
actions of parasites to keep us chasing our tails, you'll understand that PARASITES are the
mRNA editors. The longer they remain active in your system, the more likely you are to

One in a million (or whatever it is) of those mRNA edits fails to get deleted by your body's fail safe,
RNA polymerase, which is theoretically supposed to catch mutations or gene damage to mRNA
and delete them before they become DNA. With parasites, the mRNA edits are so frequent, that it
becomes inevitable that some changes will make it past the gatekeeper. This is especially
problematic for the vaccinated people. The number of edits they'll experience is in the billions,

nonymous (10. ) ШЕ 09/26/21 (Sun)17:00:46 Мо.341002
have a degree in microbiology.
AIDS is casued by the CHAGAS parasite, trypanosoma Cruzi. HIV was a theoretical construct they used to hide the truth, never isolated based on computer modeling, with Anthony Fauci running cover-up while people like Nobel prize-winning Kary Mullis, who invented the
PCR test, spent their career trying to expose Fauci's lies and blow the whistle on the AIDS scam only to be mysteriously murdered just before the launch of COVID, which is modified T. Cruzi. The particles they look at & call "viruses" are stress proteins created by a body
that's either infected with parasites or exposed to toxins. They are exosomes, not viruses. It's merely the correlation fallacy. They're not causative.
T. Cruzi causes AIDS in EVERY animal. Of course they call it immune dysfunction, immunopathology, etc
Chagas causes macrophage derangement -https://pubmed.ncbi.nlm.nih.gov/9464791
T. Cruzi causes autoimmune disease that causes heart disease https;//pubmed.ncbi.nlm.nih gov/25521296/
https://pubmed ncbi.nim.nih.gov/21734249/ Chagas and auto-immunity
https://pubmed ncbi.nlm.nih.gov/22951533/ Chagas causes auto-immunity in chickens
https://pubmed ncbi.nlm.nih.gov/16323421/ Chagas causes immune dysfunction by mimicking other toxins/pathogens (& carrying heavy metals on it's surface) to fool your immune system
https:/Awww.ncbi.nim.nih.gov/pmc/articles/PMC5823355/ All parasites are
https://pubmed ncbi.nim.nih.gov/29211102/ Sexual transmission of Chagas is an ordinary eve

https:/www.longdom.org/open-access/trypanosoma-cruzi-and-domestic-animals-2327-5073-1000e142 pdf
100 million people are exposed yearly in Latin America, alone, making it the MOSt prevalent STD in the world.

nonymous (ID ) ЕН 09/26/21(Sun)17:05:39 Мо.341003512
жисіе Г ona (21 KB, 720x198)

All the species of trypanosoma are given different names based on the host they аге found in. But every species is cross contagious with every other host. IE, if you take the chicken version and put itin a human, it will follow the same life cycle as if it сате from a shellfish or
cow. The indestructible eggs (oocys з identical in every species, along with the larval form otes. The adult form chang nding on the host, like the alien face hugger changing slightly depending on it's host. They call the disease v
Dourine in horses. In reality, it's all the same species, structurally and morphologically identical. It's a multi-trillion dollar cover-up that allows Big AG is Broad resistant callie hel wort ie o окота cl бекті

KNOW: https://link springer com/chapter/10.1007/978-94-011-9034-3_ 36

Anonymous (ID: ) /26/21 )17:02:42 3 3112 »

Рап 2

Т. Cruzi is EVERYWHERE, іп ай mammals, birds, & shellfish, found in 80% of randomly tested guinea pigs https:/www.ncbi.nim.nih.gov/pmc/articles/PMC46: raccoons, 77% of Argenti ats https-//pubmed.ncbi.nIm.nih.gov/3237 1222)

40% of wild pigs, 44% of Italian bats, 80% of chickens. It's the #1 cause of heart failure- І found in this МІН. ed article that | had to use the WayBack Machine to locate https://www.researchgate.net/publication/326591340 Prevention and Control of

An Overview

Mosquitos, triatome beetles, ticks, fleas, biting flies, are all vectors, but by my estimation account for less than 10% of the spread. Most outbreaks are linked to contaminated food https;//www.elsevier.es/en-revista-medicina-clinica-english-edition—462-articulo-orally.
transmitted-chagas-disease-S2387020617300992 and contaminated beverages https://pubmed.ncbi.nim.nih.gov/32781335/ & then sexual transmission is right up there.

This is the most versatile pathogen every to exist, yet the official dogmatic narrative is that it's rare, non sexually transmitted, (despite being found in the semen of every animal tested) and only spread by a single beetle. Nothing to see here. The plot thickens

inonymous (ID: ) EB 09/26/21(Sun)17:06:52 No.341003675 >

Part 4

Pretending all our problems are caused by secondary infections of viruses and bacteria instead of parasites allows Big Pharma to generate trillions by treating the second symptoms of infection that arise with immuno-compromise. Most people will live with it for 50+ years
and never get rid of it. It doesn't kill you. It just weakens you & when you get old and weak it causes secondary infections that kill you. 90% of tests will yield false negatives, so it's VERY difficult to detect. Most cases are identified post mortum by autoopsy. Or by biopsy of
lymph nodes, which only shows positive if you are in stage 3 of infeciton. This problem is compounded by the fact that doctors are trained to believe that it's exceedingly rare, and they'll try to steer you away from parasites if you bring it up, owing to their demonic Rockefeller
indoctrination combined with their narcissistic personality profiles, which are a prereq for acceptance into the medical programs. The boards all know, as do the people who write the textbooks. All the books have been written for the express purpose of covering this up, along
with the role that other parasites play, causing 60-80% of human health problems. Why would every government agency deny it's sexual transmissivity? Why haven't they done tests on US cattle to determine the prevalence on farms? Why do they continue to gaslight us and
pretend that a beetle is the only vectors, a beetle which probably accounts for less than 1% of the spread?

inonymous (ID: ) EB 09/26/21(Sun)17:08:21 Мо.341003849 »

Part 5: How do | know CO uzi? Covid strips iron off hemoglobin, much like the parasite malaria. This is a very complex task that requires the production of enzymes to digest the alpha chains, enzymes are larger and mort mplex than a virus.
The virus is analagous to a knife. The enzyme inalogous to a bomb. A parasite is analogous to a factory. A virus would have no reason or ability to do this. Parasites like Chagas, on the other hand, are known to strip iron to use iron to hyper accelerate their growth. Both
Сома and Chagas cause macorphage confusion, CD4 dysfui on, and the re: 5 endocarditis as the macrophages target the ACI ptors of € that have 51 spike 5 in them (a problem made much worse with the vaccine). Coronavirus and HIV
are the ONLY pathogens that contain s1 spike protein, a 4 letter 2quence patented by F г (which has 70 CCP members on the board) in 1 t ence. The the same base thing, though COVID has been gain of functioned SIGNIFICANTLY. Covid
long-haul syndrome 15 extremely similar to the AIDS progression. It's uncanny. The reason ADE reactions occur is that the anti-viral antibodies that you body produces post vaccine don't stick to parasites, so they end up circulating and causing acidic damage to every organ
instead. The CV19 version s s able to survive on dry surfaces for days instead of minutes, a major change, but otherwise it's pretty much the same progression

nonymous (10. ) ЕН 09/26/21(Sun)17:09:39 No.341004008 »
Part 6:

So after | figured this all out, the biggest cove-up of all time; that parasites are the main plague we face, | went searching on the chans to see if anyone else had realized it, and | found the mother of all red pills, the thing that Q has been prepping us to accept. The final
lesson. You aren't ready for this unless you've already accepted that 1) The media is a coordinated lying campaign 2) The 3 letter agencies are evil gatekeepers 3) The western medical establishment cares nothing for human life 4) There is a systemic attempt to destroy
society & freedom оп a global scale by collectivist ideologies 5) The elites are blood drinking child raping monsters pushing degeneracy on the population for a sinister purpose. Behold, the answer the all the riddles: THE РАКА:

Dr. Fauci claimed that , mig e í by “routine clos
contact.’ (May 5, 198

Association). (Mich
What could possibly go wrong:

— __ “мЛегееуегуопе has HIV:
5 "XN 'We want to challenge

l'oronto pop-upis the first of its kind anywhere,
and was born out of a recent poll suggesting many
still fear sharing food with someone HIV positive

We all have tapeworm stages in our bodies, probably going back to childhood when we ate dirt. It is not normal for these stages to
hatch and develop further. Their purpose is to stay dormant. And perhaps they do little harm this way.

But I have found that all HIV/AIDS sufferers have "tapeworm disease". The stages are hatching. This spews the tiny larvae and
cysts, plus unfertilized eggs and their bacteria all over the body, making you feel sick. Perhaps the large amounts of solvents
accumulated in the body forces them to hatch; perhaps the lowered immunity allows them to hatch.

This work remains, unequivocally, the most important thing I’ve ever written. It attempts merely to
synthesize the efforts of DRASTIC and numerous other independent researchers with whom I’ve collaborated
directly [the left-hand column below], as well as the outstanding research of those scientists who've fought against
the censorship and false narratives that obscured their findings:

Jonathan Couey Fernando Castro-Chavez
Johanna Deinert Angus Dalgleish

Simon Wain-Hobson Richard Fleming

Kevin McCairn Luc Montagnier
Rossana Segreto Jean-Claude Perez

Ah Khan Syed [pseud] Steven Quay

Jack Ward [pseud] Birger Sorenson

Dayou Zhang

My findings and conclusions on scientific censorship are based on several thousand hours of individual
research. The findings related to the HIV inserts in general, gp120, the furin cleavage site and other aspects of the
SARS-CoV-2 genome are the product of those listed above, or others referenced in the endnotes.

The implications are profound, and profoundly disturbing; the scale of the response to the first draft and
livestream has clearly shown me that my intuition about their importance was correct. I’ve published them here,
now, because the evidence has become so overwhelming that I can’t, in good conscience, withhold these
conclusions from the public. In short:

Dr. Fauci & others knew, based upon the suspicious elements of the SARS-CoV-2 genome, that the
virus had almost certainly been manipulated

They knew that such manipulations likely came from pseudovirus & insertion techniques very familiar
to US & Chinese viral vaccine & therapeutic/ МСМ programs

They immediately took steps to censor and control public & scientific discussions related to the HIV
inserts and FCS, respectively; these actions are more properly viewed as obstruction of justice

This had major implications for both the early response to the pandemic [FCS] and the long-term
impact on global public health [the HIV inserts and ‘Long COVID' sequelae]

Without hesitation, 1 would testify under oath to the veracity of the evidence in support of these
conclusions. They involve implications that are horrific regardless of which scientists, from which country, may
have been responsible for creating SARS-CoV-2. I propose the list of questions that follows on behalf of the victims
of the COVID-19 pandemic, who cannot ask them themselves. I promise you, however, that all of them are waiting
to hear the answers.

Semper Fidelis.

A

Charles H. Rixey

HIV >>> t.cruzi
Is Covid19 an airborne parasite [bioweapon]?

83

CDS:surface glycopro 65 N H5 Y EG DI P IG A 6 CASS v OT
Query MET CEA FTGGTSCAGGTATATGCGE TAGTTATCAGACT
| | | LiL
Sbjct ACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTC
CDS:surface glycopro NW SY E € 0 T P IG AG IC AS V9 T
CDS:surface glycopro ЖР У А 5 QS І ТА ҮТ
Query TH THERE EET HIT TTT Mitt yt TTGCCTACACTA
| | | 005 | | |
Sbjct LDA CREE Gate AC AGIGTAGCTAGTCAATCCATCATTGCCTACACTA
CDS:surface glycopro Д Q NaSi P- RGR A EVA SQSIIAYT

CDS:surface glycopro MS LGAENS VAY S NN TA DP T

Query TGTCACTTGGTGCAGAAAATTEAGTTGCTTACTCTABTAACTCTATTGCCATACCCACAA
| | Ш | |

Sbjct TGTCACTTGGTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAA

CDS:surface glycopro M LG A E NS VÀ X SH OAS: TA IP Т

CDS:surface glycopro 717 D 5 WT Е Be VS. БОЛ Т.М
Query 237 ТОНИНИ
ШІ ШІ ТІН | | |
Sbjct 237 ATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAG
CDS:surface glycopro 717 N D m wy E #5 MTkKkT1Swv

Now, this is really interesting because not only have we seen that the QTNS section is derived

from HIV but there is something very special about the adjacent PRRAR because that is a

furin cleavage site and as we have seen, these don't exist in this type of SARS-like virus. It's
an insertion to the viral genome, but nobody really knows how it got there (just like the HIV

sequences). In order to see where it came from we need to look outside the amino acid

It's easy enough to change a single nucleotide (a single point mutation or SNP) or even insert
or delete nucleotides (less common) but to insert 20 or 30 nucleotides with a code that works?

Nope, that has to come from another virus or else it's been done in a lab.

So, where did this code come from? Well it turns out that BLAST can tell us - with some
degree of certainty - where some of this code, particularly the bit that codes for the PRRAR

section (the furin cleavage site which is so unique), came from.

The bit that we are interested in is in the clue from Jikky. CTCCTCGGCGGGCACGTAG.

What you see is the same (misclassified SARS-CoV-2) sequences in the first 9 hits, and then
none of the remaining hits have 19/19 matches. What this means is that there is no virus
known to man that has this particular sequence in its genome prior to the discovery of

SARS-Cov-2. So where on earth has it come from?

Yes, that's right. Every single one of these patents that contains that 19nt sequence (for which

the probability of occurring by random chance is less than 1 in a billion) is from Moderna.
In order for that sequence to have arisen in that virus, the virus which was manufactured

with its HIV inserts, had to have had been infected into patented cell lines supplied by

Moderna that had that unique sequence not seen in any other virus.

In theory nothing is impossible in science, medicine or genomics. A SARS virus emerging
naturally with 3 HIV inserts at its binding sites and also containing a furin cleavage site that
doesn't exist in nature but does exist in a Moderna patent... that's seriously crazy talk. It

doesn't exist. A flying pink elephant would be a million times more likely.

Апопутоиѕ5 !!902tecpDHQ6 ID:p3uyiz7E Sat 01 Feb 2020 14:46:23 No.241942563 ЗЕ View Report
>>241942395

Has anyone started looking into the Parasite angle for the Corona Virus?. Where the "virus" symptoms are just a result of the parasite(s) infesting the hosts?.

Very surprised no one has been considering it.

Do some lose their sense of smell when they catch Covid?

Do some suffer tinnitus when they catch Covid?

Can you lose your sense of smell or get tinnitus from nerve damage?

Are there nerves from your ears and nose directly connected to your brain?

Do parasites seeking the brain utilize the neutral pathways of the nose and ear to access the brain?

Blood-brain barrier and retroviral infections

Florence Miller, - t- $ Philippe V. Afonso, 2:2 · $: + Antoine Gessain, 2:3 and Pierre-Emmanuel Ceccaldi? 3-4

» Author information + Copyright and License information Disclaimer

This article has been cited by other articles in PMC.

Abstract Go to: »

Homeostasis in the central nervous system (CNS) is maintained by active interfaces between the

bloodstream and the brain parenchyma. The blood-brain barrier (BBB) constitutes a selective filter for
exchange of water, solutes, nutrients, and controls toxic compounds or pathogens entry. Some parasites,
bacteria, and viruses have however developed various CNS invasion strategies, and can bypass the

brain barriers. Concerning viruses, these strategies include transport along neural pathways,
transcytosis, infection of the brain endothelial cells, breaching of the BBB, and passage of infected-
leukocytes. Moreover, neurotropic viruses can alter BBB functions, thus compromising CNS

homeostasis. Retroviruses have been associated to human neurological diseases: HIV (human
immunodeficiency virus 1) can induce HIV-associated dementia, and HTLV-1 (human T lymphotropic
virus 1) is the etiological factor of tropical spastic paraparesis/HTLV-1 associated myelopathy
(TSP/HAM). The present review focuses on how the different retroviruses interact with this structure,
bypass it and alter its functions.

Is lvermectin effective against Covid-19?

Why does Ivermectin lose effectiveness after 3 days of Covid-19 infection?

Could the Covid [Parasite] gain access to the brain in 3 days by utilizing neural pathways?
Does Ivermectin bypass the blood-brain barrier? [N]

Is Covid19 a biological weapon caused by a parasite?
Accidentally released or intentionally?

If intentional, what for what purpose?

Is drinking snake venom relatively harmless?

What if you inject snake venom?

Reconcile.

Are airborne pathogens difficult to contain?
Are injectable pathogens easy to contain?
Reconcile.

Was the relatively harmless airborne parasite used to create demand for the injectable one?
Which is the [real] bioweapon?

85

UNCLASSIFIED

DEFENSE ADVANCED RESEARCH PROJECTS AGENCY
675 NORTH RANDOLPH STREET
ARLINGTON, VA 22203-2114

13 Aug 21

From: COMMANDANT OF THE MARINE CORPS FELLOW, DARPA
To: INSPECTOR GENERAL

Subj: SARS-CoV-2 ORIGINS INVESTIGATION WITH US GOVERNMENT PROGRAM
UNDISCLOSED DOCUMENT ANALYSIS

Ref:(1) Executive Slide НВ0011850017 EcoHealth Alliance DEFUSE

(2) HROO118S0017-PREEMPT-FP-019-PM Summary (Selectable - Not
Recommended)

(3) PREEMPT Volume 1 no ESS HR0011850017 EcoHealth Alliance DEFUSE

(4) PREEMPT Volume 2 EHA Final HR0011850017 EcoHealth Alliance
DEFUSE

(5) SF424 2 0-V2.0 HR00118S0017 EcoHealth Alliance DEFUSE

(6) WIV Budget packet HR001118S0017 EcoHealth Alliance DEFUSE

(7) WS00094394-RR KeyPersonExpanded 2 0-У2.0 HR00111850017
EcoHealth Alliance DEFUSE

(8) WS00094394-RR PersonalData 1 2-V1.2 HROO1118S0017 EcoHealth
Alliance DEFUSE

1. SARS-CoV-2 is an American-created recombinant bat vaccine, or its
precursor virus. It was created by an EcoHealth Alliance program at the
Wuhan Institute of Virology (WIV), as suggested by the reporting
surrounding the lab leak hypothesis. The details of this program have
been concealed since the pandemic began. These details can be found in
the EcoHealth Alliance proposal response to the DARPA! PREEMPT? program
Broad Agency Announcement (BAA) НК0011850017, dated March 2018“! - a
document not yet publicly disclosed.

The contents of the proposed program are extremely detailed. Peter Daszak
lays out step-by-step what the organization intends to do by phase and
by location. The primary scientists involved, their roles, and their
institutions are indicated. The funding plan for the WIV work is its own
document. The reasons why nonpharmaceutical interventions like masks and
medical countermeasures like the mRNA vaccines do not work well can be
extrapolated from the details. The reasons why the early treatment
protocols work as curatives are apparent.

SARS-CoV-2's form as it emerged is likely as a precursor, deliberately
virulent, humanized recombinant SARSr-CoV that was to be reverse

What did Colonel Vladimir Kvachkov mean by this:

Can you give us any predictions for the nearest future?

In connection to the Coronavirus?

Yes.

What do you think, which countries could expect pressure next? Russia of course! It's going to be Russia surely. Because for America, Russia isn't an economic competitor. Now the
main efforts of the behind-the-scenes world powers are focused on causing disruption in China and Western Europe. And Russia is their target on two accounts: they want to
reduce our population numbers and to “cleanse” the territory. That is still to come.

Of course, we would like to hear your opinion regarding a practical plan of action, how to act, how to protect oneself, some recommendations. Maybe it's not your field of
expertise but maybe you could tell us something.

I'm of course, no epidemiologist. Although you could say I'm a parasitologist, because you have to be one in order to understand the power structures in Russia. So speaking as a
military doctor, epidemiologist and parasitologist, until we're able to get rid of our internal parasites who rule over us, we won't be able to tackle other parasites.

Are There Parasites in the Pfizer
"Vaccines"?

А 50 micron elongated hody, as seen in Figure 13 is a sharp
mysterious presence in the Pfizer vaccine. It appears and is
identified anatomically as a Trypanosoma cruzi parasite of
which several variants are lethal and is one of many causes of
acquired immune deficiency syndrome or AIDS. [Atlas of
Human Parasitology, 4th Edition, Lawrence Ash and Thomas
Orithel, pages 174 to 178] [9]

FOUR PARASITES
UNE. wi

FOUND IN PFIZER & MODERNA
COVID- 19 VACCINES

{у Dr. Robert О. Young |ng Media Events Case Studies. Contact Scientific Posts Blog

Oa COST Nt OAA AA E E
Scanning & Transmission Electron
Microscopy Reveals Graphene & Parasites
in CoV-19 Vaccines

February 5th, 2021 - Updated October 1st, 2021 & March
12th, 2022!

Author: Robert

[Figure 13 shows a Trypanosoma Parasite approximately 20 microns in length found in the so-
called Pfizer “vaccine”. It is composed of carbon, oxygen chromium, sulphur, aluminum,
chloride and nitrogen.]

https://archive.ph/R16RP

Do the vaccinated suffer blood clots?

Does venom cause blood clotting?

He was correct about the venom: LINK

But wrong about the water.

From where does the venom actually come?

& pubmed.ncbi.nlm.nih.gov/31030034/ Phase Contrast, Dark Field, Bright Field Microscopy,
Transmission and Scanning Electron Microscopy and Energy-
Review. > Thromb Res. 2019 Jun:178:145-154. doi: 10.1016/;.thromres 201: Dispersive X-ray Spectroscopy Reveal the Poisonous

Ep

Modulation of the mammalian coagulation system by
venoms and other proteins from snakes, arthropods,
‘nematodes and insects

AT A Sachetto *, М Mackman

Affiliations + expan Parasites found on sterile Covid-19

PMID: 31030034 DOI: 10,1016/j.thromres.2019.04.019
testing swabs: LINK
Abstract

The mammalian hemostatic system involves complex interactions between protein components of the
coagulation cascade and platelets. The fibrinolytic system removes the hemostatic plug. Dysregulation
of coagulation or fibrinolyt tems can induce bleeding or thrombosis. Animals, such as snakes,
worms and ir fe evolv express proteins that modulate the mammalian coagulation and
fibrinolytic systems. Many of these proteins have been isolated and characterized. Understanding the

mechanisms by which these exogenous factors from venoms and animal saliva modulate the

drugs. This review summ 5 our current knowledge of exogenous prote от venom and saliva

that either activate or inhibit the mammalian coagulation and fibrinolytic systems
Anonymous (10: @axxaya®) [+l 09/22/22(Thu)07-28:39 Мо.396424770 » >>396425055

Evidence of permanent genetic alteration:

https://www.mdpi.com/1467-3045/44/3/73/html

>Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line
https-//pubmed.ncbi.nlm.nih.gov/36054264/

>Pre-exposure to mRNA-LNP inhibits adaptive immune responses and alters innate immune fitness in an inheritable fashion

That last one comes to a conclusion that could have... implications... for the human species as we know it. Or knew it, depending on how bad...

Anonymous (ID: 007899) [+] 09/22/22(Thu)07:31:27 No.396425055 » >>396440084

22396424770
>Interestingly, mice pre-exposed to the mRNA-LNP platform can pass down the acquired immune traits to their offspring

If this sentence didn't fill you with a sinking sense of foreboding and dread, you didn't fully grasp its implications. Think... ТЕТІ Baked into the genome.
Inheritable from parent to child.

Do the “elites” who control the world fear losing control?
Do the “elites” of the world use parasites to maintain their control?
Do the “elites” of the world cover up science in order to protect these parasites which grant them control?

Conclusion: Humans are intentionally infected with parasites. Those parasites work their way into the
human brain or gut where they begin influencing the behavior of their hosts. Certain parasites are used to
kill enemies of the elites. Other parasites are capable of completely taking control over the host. The host is
then used to infiltrate human society where the parasite works to change that society in such a fashion as to
make it easier for the parasites to spread within that society. [parasite paradise]

But are the elites of the world the [real] enemy?
Or are they actually controlled hosts, themselves?

жз % ФМ

Marburg

Anthrax

What is the Formic Fleet?
Truth disguised as fiction?

consisted of Hive Queens, male drones, and workers." The

entire species shared a hive mind, so the loss of individual

workers did not concern them.

Who are the Workers?
Who are the Drones?
Who is the Hive Mind?

6. THE WORKERS

Who are the workers?
Which group of people acts as one collective whole?
What is nepotism?

Does this group often claim to belong to the
‘collective’?

(((Who))) [really] controls the media?

Isra elSrever ABOUT US + PROGRAMS ~ EXPLORE ISRAEL +
E [ n h

PFA TAS A. Lx 4 4 ) ана ЕН `4

AN ATTACK ON ONE JEWISH COMMUNITY
IS AN ATTACK ON ALL JEWISH
COMMUNITIES

rector
Most о

RAT

| пирин
ERACE "lel MORE
IP EIRC Tar "BER TRA

If Jews represent just 2% of the U.S. population, would it be odd for a media

‘ganization (whose parent company has a Jewish president and Jewish-majority
f C-level executives) to also have a Jewish President and Jewish Vice-President,
a Jewish-majority of Executive Vice Presidents, and a Lead Political Anchor,
Chief Political Correspondent, Chief Political Analyst, Chief Political Director,
thief National Correspondent, and Chief Washington Correspondent—all 6 of its
“Chief” anchor positions—who are all Jewish, as well as a majority—at least
13—of the network's currently-running shows having Jewish hosts?

It's almost as if...

89

Which group of people acts as thick as thieves?

thick as thieves idiom
Q save Word

Definition of thick as thieves

COMCAST 4" NBCUNIVERSAL “ NBCUniversal News Grr

Й!

Ст & СЕО Comcast Se Exec. VP, Comeast

: very close and secretive

/

National Poltical Orector. ср Legal Corresponde.

Host of Meet the Press Host of The Beat АЛМ
Ma "ot An Meter

Present. == Planning President Universal TV — President, Research 1 Meda " 6 с " Preside MBCUniversal President, Programming President, Operations &
strane UC n Aion] АЛ. Studio (NBC Televison) ) C Cu (ВСга Vet) Studios (NBC Fant (NBCSpert & NBCSN) Strategen [NEC Sport
Meet Atv Қат есі Sock at darn Mier меу / сей

Sa VP, News Speciale &
Transformation (NBC)

Nighy несе Wend а Souto ӘС ipit Се

атан

Would it be odd for а// 5 divisions of a media GEGEN to have both a Jewish
Chairman and a Jewish President? What if its National Political Director, Chief
Legal Correspondent, Chief Foreign Affairs Correspondent, and more than half of
its executive producers and hosts were also Jewish? If the General Counsel, Sr.
Executive VP, and Chairman & CEO of its parent company were Jewish as well?

It almost seems like...

90

(((Who))) [really] controls the media?

Р,
Lead Editor, Editorial Page President & GM, NYT's The
net

James Ben Wirecutters.
Dand Perpich

Aden Coen

с

09-24 Coronas
Rayer Секе wd Ponts
kay
Y

о-уеггер-ге-зепі
[over repre zent] %)

VERB
include a disproportionately large number of (a particular category or type of person),

Manging Editor
Joseph Kahn

ы?
Deputy Publisher Deputy Manging Editor Senior VP, NYT Global
Arthur Gregg Sulzbeeger Rebecca Blumenstem Paul Walborsky

Berlin Bureau Chie! Саон Europe Bureau САТ South Asia Bureau Chief Australia Bureau Chet
Amen Sree ick Lye ебу Се есен Damen Caw

Chiat White House
Correspondent
Y Baher

ес /

ғат

If roughly 2% of Americans аге Jews, is it odd that а newspaper’s Chairman & Vice
Chairman, Publisher & Deputy Publisher, Managing Editor & Deputy Managing
Editor, President & CEO’s spouse, Chief Operating Officer, and majority of its
Directors and Exec. Committee are Jewish? What if its D.C., L.A., London, Paris,
Rome, Berlin, Central/East Europe, South Asia, and Australia Bureau Chiefs, its
Editor-in-Chief of its Editorial Page and Global, Magazine, and Business Editions,
and its Chief National, International, Political, Domestic Affairs, Military, and White
House Correspondents—all but one *Chief" Correspondent—are also Jewish?

nep:o-tism

[nepe tizem] %)

NOUN

the practice among those with power or influence of favoring relatives or friends,
especially by giving them jobs:

XX Jewish Chair of the NPR Foundation Senice Vice President of News and Editorial Director

Howard Wollner Michael Oreskes

Fan Cubic, famh Ae
Geoffrey Nunberg Yerchok Edeistein

"A.
X )
Б> g
i ~
Сн Cachan ро hentay
Andy Borowtz

M e iren,

a Flatow

а Liat

About 20% of US taxpayer funded NPR's
personnel are of Jewish descent.

As merely 2% of the United States population,
why are dual American & Israeli Jewish citizens
allowed to represent about 1/5 of the US
taxpayer subsidized public radio station?

It gets worse.

92

Who controls Wall Street?
Of the 51 senior executives on Wall Street, 37 are jews or
have jewish spouses.

(jewish overrepresentation of 3,250%

Who controls Big Media?
Of the 12 senior executives of the “Big 6” media corporations,
9 are jews or have jewish spouses.

(jewish overrepresentation of 3,750%)

Who controls Hollywood?
Of the 60 senior executives of the major Hollywood studios,
50 are jews or have jewish spouses.

(jewish overrepresentation of 4,150%)

Who controls Television?
Of the 64 senior executives of the major television broadcast
networks, 57 are jews or have jewish spouses.

(jewish overrepresentation of 4,450%)

Who controls Music?
Of the 50 senior executives of the major music labels, 39 are
jews or have jewish spouses.

(jewish overrepresentation of 3,900%

Who controls Radio?
Of the 46 senior executives of the major radio broadcast net-
works, 28 are jews or have jewish spouses.

(jewish overrepresentation of 3,050%)

Who controls Advertising?
Of the 46 senior executives of the major advertising corpora-
tions, 31 are jews or have jewish spouses.

(jewish overrepresentation of 3,360%)

Who controls the News?
Of the 67 senior executives of the television and radio news
networks, 47 are jews or have jewish spouses.

(jewish overrepresentation of 3,500%)

Who controls Newspapers?

Of the 65 senior executives of the major newspapers and

news magazines, 42 are jews or have jewish spouses.
(jewish overrepresentation of 3,250%)

Who controls E-bay?
Of the 9 E-bay executives, 6 are jews or have jewish spouses.
(jewish overrepresentation of 3,350%)

Who controls Apple?
Of the 10 Apple executives, 3 are Jews or have jewish spouses.
(jewish overrepresentation of 1,500%)

Who controls Yahoo?
Of the 13 Yahoo executives, 8 are jews or have jewish spouses.
(jewish overrepresentation of 3,100%)

Who controls Google?
Of the 6 Google executives, 4 are jews or have jewish spouses.
(jewish overrepresentation of 3,350%)

Who controls Amazon?
Of the 11 Amazon executives, 8 are jews or have jewish spouses.
(jewish overrepresentation of 3,650%)

Who controls Facebook?
Of the 3 Facebook executives, 3 are jews or have jewish spouses.
(jewish overrepresentation of 5,000%

Who controls Microsoft?
Of the 17 Microsoft executives, 6 are jews or have jewish spouses.
(jewish overrepresentation of 1,750%)

Who controls the Economy?
Of the 60 senior officials of the US monetary institutions, 39 are
jews or have jewish spouses.

(jewish overrepresentation of 3,250%)

Who controls the Mutual Fund Industry?
Of the 40 senior executives of the major Mutual Funds on Wall
Street, 26 are jews or have jewish spouses.

(jewish overrepresentation of 3,250%)

Who controls Professional Sports?
Of the 60 senior executives of the major sports leagues, 43 are jews
or have jewish spouses.

(jewish overrepresentation of 3,600%)

Who controls the Southern Poverty Law Center?
Of the 22 senior members, 15 are jews or have jewish spouses.
(jewish overrepresentation of 3,100%)

Who controls the American Civil Liberties Union?
Of the 9 executives of ACLU, 4 are jews or have jewish spouses.
(jewish overrepresentation of 2,200%)

93

Who controls Goldman Sachs?
Of the 9 GS executives, 7 are Jews or have jewish spouses.
(jewish overrepresentation of 3,900%

Who controls JPMorgan?
Of the 10 JPM executives, 9 are jews or have jewish spouses.
(jewish overrepresentation of 4,500%)

Who controls the Treasury Department?
Of the 26 senior Treasury officials, 18 are jews or have jewish
spouses.

(jewish overrepresentation of 3,450%)

Who controls the Federal Reserve System?
Of the 7 FR governors, 4 are jews or have jewish spouses.
(jewish overrepresentation of 2,850%)

Who controls the White House?
Of the 11 senior advisors of president Obama, 9 are jews or
have jewish spouses.

(jewish overrepresentation of 4,100%)

Who controls Senate?
Of the 20 US Senate Committee Chairmen, 8 are jews or have
jewish spouses.

(jewish overrepresentation of 2,000%)

Who controls Congress?
Of the 42 US House Committee chairmen, 6 are jews or have
jewish spouses.

(jewish overrepresentation of 700%)

Who controls the Supreme Court?
Of the 9 SC justices, 4 are jews or have jewish spouses.
(jewish overrepresentation of 2,200%)

Who controls the State Department?
Of the 74 senior SD officials, 40 are jews or have jewish spous-
es.

(jewish overrepresentation of 2,700%)

Who controls the Justice Department?
Of the 47 JD officials, 22 are jews or have jewish spouses.
(jewish overrepresentation of 2,360%)

Who controls the Anti-Defamation League?
Of the 53 executives of the ADL, 53 are jews or have jewish
spouses.

(jewish overrepresentation of 5,000%)

Who controls the Defense Department?
Of the 110 DD officals, 40 are Jews or have jewish spouses.
(jewish overrepresentation of 1,800%)

Who controls the Group of Thirty?
Of the 43 GoT members, 23 are jews or have jewish spouses.
(jewish overrepresentation of 21,200%)

Who controls the Bilderberg Group?
Of the 35 committee members, 16 are jews or have jewish
spouses.

(jewish overrepresentation of 4,600%)

Who controls the Trilateral Commission?
Of the 56 committee members, 23 are jews or have jewish
spouses.

(jewish overrepresentation of 16,400%)

Who controls the Council on Foreign Relations?
Of the 43 CoF directors, 28 are jews or have jewish spouses.
(jewish overrepresentation of 3,250%)

Who controls the Ivy League?
Of the 24 senior administrators, 20 are jews or have jewish
spouses.

(jewish overrepresentation of 4,150%)

Who controls the Think Tanks?
Of the 30 senior executives, 18 are jews or have jewish spouses.
(jewish overrepresentation of 3,000%)

“We have corrupted the blood of all the races of Europe
— perhaps we have infected them. Today, everything is
Jewdified. Our thinking is in everything living, our spirit
rules the world. We are the masters, for everything that
has power today is the child of our spirit. One may hate
us, one may drive us away. Our enemies may triumph
over our physical weakness. But we are no longer to be
gotten rid of. We have devoured the peoples, conquered
the races, defiled them, broken their strength, made eve-
rything rotten, lazy, and corrupt with our stale culture.
Our spirit can no longer be exterminated.”

-Dr. Kurt Münzer [Jew] in his novel 'Der Weg nach
Zion' (The Way to Zion)

It gets worse.

94

List of most popular websites

From Wikipedia, the free encyclopedia

Alexa top 100 global SimilarWeb top 100
Domain websites websites Type
(As of April 3, 2017)/2! (As of May 2017)!

Principal
country

google.com Internet services and products ЕЕ 05.
youtube.com Video sharing ШЕШ 05.
facebook.com Social network =z US.

Mark Zuckerberg Facebook, Inc. Sheryl Sandberg

facebook

Key people Mark Zuckerberg
(Chairman and CEO)
Sheryl Sandberg

(СОО)
Sandberg was born іп 1969 іп

Zuckerberg was raised|Jewishjand had his Ваг Р
9 Sundar Pichai Washington, D.C. to a[Jewist]famity

Mitzvah when he turned 13.1211

Alphabet Inc.

oe || 7mm.

August 2014 "Do the right thing"
Type Subsidiary Formerly Google Inc. (1998-2015)

ES
(used from 2004-2015)

Internet Larry Page
Computer software
Computer hardware
September 4, 1998; 18
years ago
Menlo Park, Californial!1t2]
Founders Larry Page

Sergey Brin "-
Headquarters Googleplex, Mountain 8 HAA R E I Z

View, California, U.S.) à
Tund MM Lawrence Edward Page was born on March 26, 1973, in East

Key people Sundar Pichai (CEO) Lansing, Michigan. His father, Carl Vincent Page, Sr., was a
Larry Page (CEO -
Alphabet Inc.)

Sergey Brin (President = his mother, Gloria W. Page, also taught computer programming.
Alphabet Inc.) Page speaking at the European Parliament on

June 17, 2009 Gloria i Jewish] Carl, who died, in 1996, was not. Susan Wojcicki
YouTube, LLC

Pichai was born in Madurai, Tamil Nadu, India

professor of computer science at Michigan State University, where

Sergey Brin
Early life and education езі]

Brin was born in Moscow in the Soviet Union, to
Russian Pewish] parents 0 | | e

Spouse(s) Anne Wojcicki (m. 2007;

div. 2015)/41°1
YouTube now operates as one of Google's subsidiaries.

Anne Wojcicki

e

She is the current CEO of YouTube.

Sergey Brin in 2008 She is the daughter of Esther Wojcicki, an educator of Russian|Jewish|des

Anne E. Wojcicki (/моо d3rtski/ woh-JIT-skee; Polish: Wójcicka pronounced [vuj Yitska}; born July 28, 1973) is an American entrepreneur
and the co-founder and chief executive officer of the personal genomics company 23andMe. She was formerly married to Google co-
Her mother is Her sisters are Susan Wojcicki, CEO of YouTube and a former executive at Google

Wojcicki at TechCrunch Disrupt SF 201

What are the chances that 2% of the US population
would produce those who control the three biggest
websites? Its almost like they're working together.

90% of american media is owned by 6 corporations: a demonstrable fact everyone can research and see.
The CEOs and executives of those 6 corporations are jewish: also demontrable by looking at those corps employee charts.
But Jews insist in calling it a "conspiracy theory", even though no "conspiracy" is involved, and none of this is theoretical.

Peter Chernin ХХ Gerald ТеуіпХХ Michael LyntonXX Brian RobertsKX Sumner RedstoneXx Michael Eisner XX
News Corp Фу 7 TimeWarner SONY COMCAST масом

J
EF ао ge.
[] NATIONAL

GEOGRAPHIC

CHANNEL

hulu »

е... өше T
ТІМЕ

өй іа
Entertainment Southern Living

hulu

THE INTERNATIONAL JEW:
Controlling the world's sources of news, All ! THE WORLD'S

Judaan [Jews] can always prepare the minds of FOREMOST PROBLEM
the people for its next move. The greatest ге

exposure yet to be made is the way that news is

manufactured and the way in which the mind of

whole nations is molded for a purpose. When the
powerful Jew is at last traced and his hand j

revealed, then comes the ready cry of persecution

and it echoes through the world press. The real / N
causes of the persecution (which is the oppression - d
THE COMPLETE

of the people by the financial practices of 5.2
4 VOLUMES
the Jews) are never given publicity

HENRY FORD. 1920

96

Who are the workers?

Do members of the jewish race have a naturally weakened immune system?
Would this make them ideal hosts for parasite-infested mind control?

WATCH KABBALAT SHABBAT LIVE! // Stream services here at 7:25 pm Central/8:25 pm Eastern. —>

included in an expanded 38-disease panel. Another 16 diseases

for genetic testing recommended by the Jewish

Genetic Diseases Consortium. An additional 19 are

are common among particular groups of Sephardic * | and/or
Mizrahi * Jews. Information on the latter two groups of

Di :
diseases are available on the JGDC website. purs

Asked Que

HEALTH & WI

Bloom Syndrome

Advertisement
Bloom syndrome is a disorder that can result in short stature,

skin rashes, sensitivity to sunlight, high-pitched voice,

distinctive facial features, infertility and a heightened risk of My Jewish Learning is a not

several other diseases, including cancer, pulmonary disease and relies on your hq
immune system abnormalities. Life span is often significantly DONATE
shortened due to susceptibility to cancer and other

complications. Carrier frequency is one in 134 Ashkenazi «

Jews.

Further Resources:
National Institutes of Health

Bloom's Syndrome Foundation

Bloom's Syndrome Association
BloomSyndrome Foundation (Netherlands)
Bloom's Syndrome Registry

Blooms Connect

Canavan Disease

Canavan Disease is caused by the deterioration of white matter in the brain, which in
turn impedes the function of nerve cells throughout the body. Symptoms typically occur
within the first nine months of life and include a failure to develop basic motor skills,
enlarged head and poor muscle tone. Over time, seizures, difficulty in swallowing,
paralysis and retardation can result. Affected individuals typically live through childhood
only, though some have survived into adolescence and beyond. A milder and less common
form of the disease features far less dramatic symptoms that are sometimes never
recognized and do not appear to shorten lifespan. About 1 in 55 Ashkenazi Jews are

carriers of the disease.

Further Resources:
National Institutes of Health
Canavan Foundation

Canavan Research Foundation

Cystic Fibrosis

Cystic Fibrosis is a condition in which the body produces a thick mucus that can clog the
lungs and impair organ function. Symptoms can include wheezing, chronic coughing and
inflammation leading to breathing problems and bacterial infections in the lungs. Over
time the condition can cause digestive problems and reduced pancreatic function.
Improved treatments have led to increased lifespan in recent decades, with many sufferers
in the United States now surviving into their 30s and 40s. Carrier frequency is about 1 in
24 Ashkenazi Jews and about 1 in 26 Sephardic/Mizrahi Jews.

Further Resources:

National Institutes of Health

Cystic Fibrosis Foundation

Boomer Esiason Foundation

Cystic Fibrosis (online community)

CF Living

Cystic Fibrosis Worldwide

Cystic Fibrosis-Reaching Out Foundation
Cystic Fibrosis News Today

Familial Dysautonomia

Familial Dysautonomia is a disorder that affects the autonomic nervous system, which
controls involuntary actions, and the sensory nervous system, which controls activities
related to the senses. The disorder features a wide range of symptoms that typically begin
in infancy and increase in number with age. These include poor muscle tone, feeding
difficulties, poor growth, lack of tears, frequent lung infections and difficulty maintaining
body temperature. In older children, the disease can result in bed wetting, vomiting,
reduced sensitivity to temperature and pain, poor balance, scoliosis, kidney and heart
problems, and learning difficulties. Affected adults can suffer from lung and kidney
problems and impaired vision. The disease results in shortened lifespan, with affected
individuals born in 2006 projected to have a 50 percent chance of survival to age 40.

About 1 in 31 Ashkenazi Jews are carriers of the disease.

Further Resources:
National Institutes of Health

Dysautonomia Foundation

National Dysautonomia Research Foundation
Familial Dysautonomia Now Foundation
Familial Dysautonomia Hope Foundation
Dysautonomia Youth Network of America

Familial Hyperinsulinism

Familial Hyperinsulinism is a condition that causes irregular levels of insulin, the
hormone that controls blood sugar levels. Symptoms can occur very soon after birth, and
can include lethargy, hypoglycemia, seizures and difficulty feeding. Repeated episodes of
low blood sugar can lead to more serious complications. Treatment with drugs or glucose
injections can help manage the disease. Surgery to remove all or part of the pancreas is
also common. The carrier frequency for Familial Hyperinsulinism is about 1 in 68

Ashkenazi Jews.

Further Resources:
National Institutes of Health

Congenital Hyperinsulism International

Fanconi Anemia C

Fanconi Anemia C is one of several subtypes of a disorder that impairs the ability of bone
marrow to produce new blood cells. Signs of the disease are often apparent at birth.
Affected individuals often suffer from bone marrow failure, infertility, short stature,
increased incidence of certain types of cancer, gastrointestinal difficulties and various
physical abnormalities. Drugs and bone marrow transplantation are used to manage the
disease, but most of those affected die in early adulthood. The carrier frequency among
Ashkenazi Jews is 1 in 100.

Further Resources:
National Institutes of Health

Fanconi Anemia Research Fund

Gaucher Disease

Gaucher disease is the most common genetic disease affecting Ashkenazi Jews. The disease
results from a specific enzyme deficiency that can impact many of the body's organs and
tissues. There are various types of the disease. The most common is Type 1, whose
symptoms include enlargement of the liver and spleen, anemia, low red blood cell count,
lung disease and bone abnormalities. Other forms of the disease affect the cardiovascular
and central nervous systems. Symptoms can vary widely in intensity. Some of those
affected with the more severe forms may suffer extremely shortened lifespans, while
others can manage the disease successfully over the long term. The carrier frequency for

Ashkenazi Jews is about 1 in 15.

Further Resources:

National Institutes of Health
National Gaucher Foundation
Children's Gaucher Research Fund

Joubert Syndrome 2

Joubert Syndrome 2, also known as Cerebelloculorenal Syndrome, is a subtype of a
condition whose symptoms include poor muscle tone, abnormal eye movements,
intellectual disability and poor motor coordination. Though symptoms can vary, the
condition is marked by the underdevelopment of the cerebellar vermis area of the brain,
which controls balance and coordination. The condition can also be associated with
kidney or liver failure. Symptoms typically begin in infancy. Treatment options are solely
supportive and symptomatic. The carrier frequency among Ashkenazi Jews is 1 in 100.

Further Resources:
National Institutes of Health

Joubert Syndrome & Related Disorders Foundation

Lipoamide Dehydrogenase Deficiency (E3)

Lipoamide Dehydrogenase Deficiency (E3) is a condition caused by an enzyme deficiency
that leads to the buildup of lactic acid in the body. The symptoms typically present in
childhood and are quite varied, including serious fatigue, episodes of hyperventilation,
vomiting and abdominal pain. The disorder can be fatal in childhood, though it can also
often be managed through diet and immediate medical attention when lactic acid buildup

occurs. The carrier frequency among Ashkenazi Jews is 1 in 107.

Further Resources:
National Institutes of Health

Genetic Disease Foundation

Maple Syrup Urine Disease (1B)

Maple Syrup Urine Disease is a disease characterized by deficiency in enzymes needed to
break down certain amino acids. The disorder derives its name from the distinctive sweet
odor of the urine of those affected. Symptoms typically begin shortly after birth and
indude irritability, poor feeding and lethargy. The disease can usually be successfully
managed through a strict dietary regimen, but left untreated can lead to neurological

damage, seizures, coma and death. The carrier frequency among Ashkenazi Jews is 1 in 97.

Further Resources:
National Institutes of Health

National Organization for Rare Disorders
MSUD Family Support Group

Mucolipidosis IV

Mucolipidosis IV is a disorder characterized by severe underdevelopment of intellectual
and motor skills. Symptoms are usually apparent within months of birth. Many of those
affected have limited or absent speech, impaired vision, difficulty walking independently,
digestive problems and poor muscle development. Though many of those affected by the
disease survive into adulthood, they may still have shortened lifespan. The carrier
frequency among Ashkenazi Jews is 1 in 89.

Further Resources:

National Institutes of Health

National Organization for Rare Disorders
Mucolipidosis IV (ML4) Foundation

Nemaline Myopathy

Nemaline Myopathy is a disease characterized by muscle weakness, typically in the face,
neck and other muscles close to the center of the body. Symptoms are generally present in
childhood and can vary widely in intensity. In severe cases, weakness in the respiratory
muscles can be life-threatening, but in most cases affected individuals can lead active

lives. Carrier frequency in Ashkenazi Jews is 1 in 168.

Further Resources:

National Institutes of Health

National Organization for Rare Disorders
A Foundation Building Strength

Nemaline Myopathy Support Group
Walker Warburg

Walker Warburg is a disease characterized by severe abnormalities in the muscles, brain

and eye. Symptoms are typically evident very early in life and include severe retardation,
small head, poor muscle tone, small eyes, blindness, seizures and feeding difficulties. Most
affected individuals do not survive past the age of three. Carrier frequency is 1 in 120 for

Ashkenazi Jews.

98

Niemann-Pick Disease

Niemann- Pick refers to a collection of metabolic disorders characterized by an enzyme
deficiency that leads to the buildup of certain types of lipids in the body. Individuals
affected with the most severe and most common form, Type A, typically develop an
enlarged liver and spleen within the first three months of life, followed by a progression
of other symptoms that normally lead to death within the first four years. Other subtypes
generally develop later and are not as severe. Carrier frequency among Ashkenazi Jews is
lin 115.

Further Resources:
National Institutes of Health

National Niemann-Pick Disease Foundation

Spinal Muscular Atrophy

Spinal Muscular Atrophy is a disorder caused by the loss of motor neurons in the spinal
cord and brainstem. The disease has multiple types distinguished by the age of onset and
the severity of symptoms. In the most severe forms, symptoms begin very early and often
lead to death within several months to two years as a result of respiratory problems. With
milder forms, symptoms begin later in childhood or even into adulthood and, depending
on their severity, can sometimes permit a normal lifespan. All forms of the disease involve
some degree of muscular weakness that can lead to atrophy as well as difficulty walking,
breathing and eating. Carrier frequency is 1 in 41 for Ashkenazi Jews and 1 in 10 for
Egyptian Jews.

Further Resources:
National Institutes of Health
Cure SMA

FightSMA
Spinal Muscular Atrophy Foundation
Spinal Muscular Atrophy

Tay-Sachs Disease

Tay-Sachs Disease is a disorder characterized by an enzyme deficiency that destroys
neurons in the brain and spinal cord. The most common form of the disease begins
within months of birth and entails the progressive loss of motor skills,
neurodegeneration, seizures, blindness, spasticity and eventually total incapacitation and
death. A far more rare form of the disease begins later in life, from childhood to
adolescence and beyond, and the symptoms are milder, though they include poor
coordination, tremors and slurred speech. As the disease progresses, it can lead to mental
and behavioral abnormalities, induding bipolar disorder and psychoses. Carrier frequency

for infant onset Tay-Sachs among Ashkenazi Jews is 1 in 27.

Further Resources:
National Institutes of Health

National Tay-Sachs and Allied Diseases Association
Cure Tay-Sachs Foundation

Torsion Dystonia

Torsion Dystonia, also known as dystonia musculorum deformans, is characterized by
muscle spasms, contractions, and tremors. Symptoms usually begin in early childhood
and are progressive. Sometimes symptoms are isolated in one part of the body, and
sometimes affect many. The disease is caused by a mutation in the TOR1A gene, but not
all people with the mutation develop the disease (only 30-40%). Somewhere between 1 in
3000 and 1 in 9000 Ashkenazi Jews are affected by this disorder.

Further Resources:

National Institutes of Health

Usher Syndrome

Usher Syndrome is a disorder that affects nerve cells in the ear and photoreceptor cells in
the retina. The disease is marked by total or partial loss of vision or hearing that worsens
with time. There are several types of the disease. In Type 1, affected individuals are
typically born with hearing loss and difficulty balancing due to abnormalities in the inner
ear. In Type 3, vision and hearing loss typically begin later in life. Carrier frequency for
Type 1F is 1 in 147 for Ashkenazi Jews and 1 in 120 Ashkenazi Jews for Type 3.

Further Resources:

National Institutes of Health
Usher Syndrome Coalition
Hear See Hope

Who are the workers?

Why do jews often claim to be part of the ‘collective’?
Do parasites cause schizophrenia?

Are jews prone to schizophrenia?

@ pubmed.ncbi.nim.nih.gov/7973467/

Abstract

To limit the genetic heterogeneity of schizophrenia, this study focused on the widely extended
pedigrees of Ashkenazi Jewish schizophrenia probands. The hypothesis posed is that the increased
prevalence among the Ashkenazim of the rare lysosomal enzyme disorders, Tay Sachs disease (TDS),
caused by low levels of hexosaminidase A, and Gaucher's disease (GD), caused by low levels of
glucocerebrosidase, might contribute to the demonstrated increased vulnerability to schizophrenia in
this ethnic group. Signs and symptoms characterizing the candidate illnesses were systematically
queried by the family history method. Rates and relative risks for symptoms characterizing these
disorders and for several nonautosomal illnesses associated with TSD and/or GD (i.e., amyotrophic
lateral sclerosis and Hodgkin's disease, leukemia and lymphoma) are significantly elevated in the
schizophrenia pedigrees, compared to controls. The conditions with elevated rates and risks have
been associated with chromosomal regions 1q21 and 15q23-q24. These areas are suggested as
candidate regions for future targeted deoxyribonucleic acid (DNA) research in schizophrenia.

Jewish insanity

Among the Jews, the proportion of insane has been
observed to be very large.’ From statistics collected by
the German researcher Buschan in the late 19th
century, he concludes that they are four to six times
more liable to mental disease than are non-Jews.
Lombroso quotes Servi ("Gli Israeliti di Europa," 1872)
to the effect that in Italy there is one insane among 391
Jews, nearly four times as many as among the Catholic
population of that country. Verga ("Archivio di
Statistico," 1880) shows that in 1870 there was one
insane among 1,775 Catholics in Italy, while with the
Jews it reached the alarming proportion of one insane in

i

+ “AN
ге!
n Nos. 9

Е 384 of population. A similar phenomenon has been
52 . observed in other countries. In the various provinces of
E ЕН Germany and also іп Denmark the percentage of Jewish
a insane is very large, as is seen from the figures in the

appended table on the left.

Maximoff and Sikorsky (Proceedings of the Twelfth International Medical Congress," vol. iv., part 1., p.
661.) have shown that similar conditions prevail in Russia. Among the troops in Kiev, respectively 0.91%
and 0.99% of Russians and Poles were determined to be insane. For Jews, this number was more than

twice as high: 2.19%.

C. F. Beadles, who has investigated the subject in the Colney Hatch Asylum in London, shows that there
appears to be a great preponderance of general paralysis among Jewish males, over 21 per cent of all the
male Jews admitted being subjects of that disease, while the proportion of cases of general paralysis among
all the males admitted to the hospitals for the insane in England and Wales is only 13 per cent. "It is
evident," says Mr. Beadles "that among the Jewish males, admissions for general paralysis are 60 per cent
more frequent than among the non-Jewish English and Welsh."

The frequency of general paralysis in Jews observed by Beadles is confirmed by Hirschl, who found among
200 of his paretic patients 40 Jews, 1.е., 20 per cent (Hirschl, "Zur Aetiologie der Progr. Paralysis," in
"Jahrbuch für Psychiatrie," xiv. 449). Pilez also found a large proportion of pareties among the Jews in
Vienna: 18.75 per cent of all cases. He adds that the Jews' acute struggle for existence, and their peculiar
occupations as merchants, speculators, stockbrokers, etc., are etiological factors.

[1] http://www, jewishencyclopedia.com/articles/8 1 23-insanity

99

Who are the workers?

Why do jews often claim to be part of the ‘collective’?

Do jews use patriarchal lineage or matriarchal lineage to determine ‘Jewishness’?
Define ‘congenital transmission’?

[...from mother to child]

What is the [real] reason jews use matriarchal lineage to determine ‘Jewishness’?

| Chagas Disease сап also Бе
transmitted:

* Congenitally from mother to child
|“ Through blood transfusion
* Through organ transplantation

If the parasite fails to transfer in utero, is there an alternative method Jews use to transfer their parasites?
Do parasites prefer young hosts?

Are mind-controlling parasites sexually transmitted?

Can they be transmitted through spit and saliva?

Would an open wound facilitate this transfer?

What is 'Direct Oral Suction’?

Circumcision >>> Parasite
Parasite >>> Mental Illness
Mental Illness >>> Hive Mind
Hive Mind >>> Collective

Why do jews [really] claim to be
part of the ‘collective’?

100

@ rules.cityofnewyork.us/tags/direct-oral-suction
Search | Email Updates | Contact Us
/isitors Government Office of the Mayor

SET TEXT SIZE: [=] [+] E) Ti TRANSLATE THIS PAGE = PRINTER FRIENDLY LOGIN | REGISTER

direct oral suction

Adopted Rules: Closed to Comments

Adopted Rules Content:

Statement of Basis and Purpose

Statutory Authority

These amendments to the Health Code are promulgated pursuant to sections 558 and 1043 of the
Charter. Sections 558(b) and (c) of the Charter empower the Board to amend the Health Code and
to include in the Health Code all matters to which the authority of the New York City Department of
Health and Mental Hygiene (the "Department") extends. Section 1043 of the Charter grants the
Department rule-making authority. The amendment is also made pursuant to the Department's
historic power to supervise the control of communicable disease in New York City.

Background

The Charter provides the Department with broad jurisdiction to protect and promote the health of all
New Yorkers. The control of communicable disease is a core public health function. At its meeting
on September 13, 2012, the Board of Health voted to amend Article 181 by adding a requirement
that, prior to a circumcision involving direct oral suction (“005”) of infants less than 60 days of age,
the person performing the circumcision obtain the written consent of a parent. In the consent, the
parent acknowledges that he or she is aware that the Department recommends DOS, also known
as metzitzah b'peh, not be performed because of the risk of brain damage and death.

Circumcisions that include DOS involve direct contact between the mouth of the practitioner
designated by the religious community to perform a circumcision, known as a mohel, and the
infant's circumcision wound. The opposition of some members of the Orthodox Jewish community
who practice DOS has made enforcement of the consent requirement difficult. Since the provision
went into effect, there have been six cases of herpes simplex-1 (HSV-1) infection reported in
infants following DOS in New York City, including four cases reported in 2014. In two of these six
cases, the mohel who was associated with the case was identified in the course of the
Department's case investigation, and a signed consent form was provided by the mohel in one of
these two cases. The limited effectiveness of the consent requirement at this time prompted the
department to consider alternative approaches to address this problem.

In February, 2015, the Mayor announced a new strategy to address this problem. As part of this
approach, the Department will work cooperatively with leaders of the Orthodox Jewish community
to educate parents about the risks of DOS. These educational efforts will include working with
hospitals throughout the City to distribute educational materials about the risks of DOS to the
parents of all newborn infant boys, as well as making this information available at other health care
settings, such as obstetric and pediatric practices. These materials, which include a Department
telephone number for parents who may have questions, have been translated into Yiddish and are
being distributed at hospitals and medical offices that service communities where DOS is
practiced. The Department's educational initiative is more likely to succeed if the Department can
restore a strong relationship with these communities. Accordingly, the Board is repealing section
181.21 of the Health Code.

101

Do the infected live in filth and squalor?
Are jews sometimes referred to as ‘goblins’?
Why is ‘goblin mode’ spreading?

J that men and women were
w of one another, They have
toilets, But these god.
up. The filth,” Craig
rooms 1 saw six

Life and style
Slobbing out and giving up:
why are so many people

going ‘goblin mode’?

THE WORMS CRAWL IN, THE WORMS CRAWL OUT —

Old stone toilet reveals Jerusalem’s wealthy
elite had intestinal parasites

Scientists identified egg remnants from roundworm, tapeworm, whipworm, and pinworm.

1/14/2022, 11:44 AM

Does early infection result in morphological changes to the
host's body?

Could this be used to identify the infected?

[а]

@ pubmed.ncbi.nlm.nih.gov/23225875/

What is ‘Aggressive Mimicry’?

> J Exp Biol. 2013 Jan 1;216(Pt 1):127-33. doi: 10.1242/jeb.073635.

Influence of latent Toxoplasma infection on human
personality, physiology and morphology Sees
cons of the Toxoplasma-human model in studying
the manipulation hypothesis

Wasmannian Mimicry

In Wasmannian mimicry, the mimic resembles a model that it lives along with
in a nest or colony. The mimic, a predator, appears as a friend and member of the
same species, taking on its appearance and mannerisms.

Aggressive mimicry

From Wikipedia, the free encyclopedia

Aggressive mimicry is a form of mimicry in which predators,
parasites, or parasitoids share similar signals, using a harmless
model, allowing them to avoid being correctly identified by their

prey or host. Zoologists have repeatedly compared this strategy
to a wolf in sheep's clothing. 2131
aggressive mimicry could include various types of exploitation,

14 In its broadest sense,

SW EU

European woman (top) ы
Jewess (bottom)

Ant in Mozambique (top)
Mimic, a jumping spider (bottom)

Ш Anonymous (ID

102

Can dogs detect parasites?
Do dogs become aggressive against the infected?

Do jews like dogs? Who Doesn’t
Love a Cute

Puppy? г.

. Jews, traditionally. |

All dogs are bad and
their owners accursed,
Israeli city's rabbis rule

Religious edict in haredi town of Elad says
canines are forbidden because they bark at
people and may scare them: 'And because of
its bark it is a bad dog even if does not bite’

By CNAAN LIPHSHIZ
12 July 2019, 4:50 pm |

LHE JERUSALEM POST CORONAVIRUS ISRAEL NEWS WORLD NEWS MIDDLEEAST BUSI

Dog tax proposed by haredi

An annual fee, proposed by United Torah Judaism MKs Moshe Gafni
| 6 k ere

Dogs can smell when one is infected with parasites:

4.3.4 The Dog of Alba

Another literary tradition, which, however, is not connected to the culinary topoi discussed so far,
but which is gladly taken up in connection with the topic of the foetor judaicus, is the story about the
dog of Alba. The story must have been told before the expulsion of the Sephardim from the Spanish
kingdom in 1492, since it involves the Jewish community of Alba. According to Joseph Eugene
Gillet (1888-1958), Professor of Romance Languages, who analyzed and published the various texts
in an essay, the oldest version known today, which was written in verses, comes from Johannes de
Trasmiera, whose texts probably appeared in print іп 1524 or a short time later."

The story tells of the dog of Anton Gentil, who attacks only Jews іп the city of Alba. Alba
probably means the small town of Alba de Tormes, in which the ancestral seat of the Dukes of Alba
is located, because the duke is also referred to in onc place.** Should the Duke of Alba actually be
meant, the period of the story can be narrowed down even more, because the Alvarez de Toledo
family were Counts of Alba until 1472 when Castilian King Henry IV conferred the title of duke

on them. Consequently, there remains a window of twenty years, from 1472 to 1492. Thus the
probability increases that the story could not have been written too long before 1524, if the first

version that we have received from Johannes de Trasmiera was not even the first one. The story goes

AC зогу BOCS
on to explain that Jews take the biting dog to court. The judge sentences the dog to death and lets
him be handed over to the Jews so that they can punish him and take revenge. However, the dog

is would-be executors again. to move to
coming into the city, even if he is disguised as a Christian:

“If any Jew showed up

disguised as a Christian,

and touched him [the dog] with their hand,
which he [the dog] immediately kissed,

he tore the Jew's hand apart,

since such a disguise did not trick him,

if a Christian dressed like a Jew,

he then remained seated.”*5

Stigmatizing New Christians in Early Modern Spain- Julia Gebke

(10: -DFt4lpüR ) == 10/28/21(Thu)23:49:22
0.345241781 »

22345224619 #

I'm trans but i like to pretend I'm not when
Dogs Can Sense I'm on the internet. | dont really have a lot

Bad People of friends in real life. | think they don't

according bs science really like my humor. | never really feel
like | have a community more than when
I'm teasing other transgenders on 4chan
d because I've never seen a group of

people having more fun. | don't blame

Dogs Can Sense Bad iris them for hating us because i hate myself

too.

i | have a friend from childhood who told
People according to me to get a pet and i really like doggos
but | noticed that every dog seems to
science. hate me so i don't want to get one. | think

its because i STANK

104

An interesting story: >you probably won't believe this but..

If you think that is unbelievable. Let me tell you my story. When I was young, | distinctly
remember the day my life changed. | was an outgoing, charismatic child who quickly
made friends with everyone. My parents even had to impose limits on the number of kids
| could invite to my birthday parties (to the disappointment of many). Then, when | was
11, | specifically remember not only the day, but even the very moment 1 lost control over
my behavior. A spirit of fear came upon me so suddenly and with such force that I lost
the ability to speak to strangers, nor could | even stand in front of crowds without visibly
shaking in abject terror. | also noticed around this time, dogs began to attack me on sight.
Not just one dog, or two dogs, but a great many dogs. Even the friendliest of them would
not hesitate to sink their teeth deep into any part of me that | carelessly left exposed.
Their owners were always flabbergasted and apologized to no end, but | learned to
expect it, and | had to keep my distance from certain breeds.

What makes my story even more strange was that | also distinctly remember not only the
day, but even the very moment | regained control over my body. It was exactly 20 years
later. | was required to give a speech, and | suffered so much mental anguish from it that
| felt like something inside of me suddenly broke. That moment, whatever had been
controlling my body had vanished. Within a week, the crippling fear which had previously
enveloped my mind was now no more. What is even more strange is that giving public
speeches suddenly became my new favorite thing in the whole world. It was as if my life
had returned to the state in which it was in back when | was eleven. Even dogs forgot
their hatred of me.

It is strange to think of it now because | can remember the feeling of losing control, and |
can remember the feeling of regaining it. Is it weird that | wonder if maybe | had
something inside of me; something that those dogs could detect but | could not?

| probably would have forgotten all of this but for a very similar thing happening to my four
year old niece. You see, a family member of mine has the friendliest dog in the world.
But for reasons that we did not understand, one day, the dog tries to kill my niece. She
was not hurt, but we have had to keep the dog and my niece separated ever since. No
one understood why. We still don't understand why, but something strange happened to
my niece not long after this. You see, almost a year later, my niece is suddenly
diagnosed with a massive brain tumor.

No one believes my theory, but | can't help wondering if, just like me, something had
gotten inside my niece, and the dog could sense it. And whatever that thing was inside of
her, it somehow caused that tumor. | know this sounds unbelievable, but do you think
dogs can sense ghosts, or whatever that thing was inside of her and me?

Ш medicalnewstoday.com/articles/323620#summary

= NEWSLETTER MepicaLNewsTopay

Can dogs sense tumors?

Researchers are currently exploring the possibility of using specially trained medical detection
dogs in the diagnosis and tracking of cancer.

Canine cancer detection is a simple, noninvasive procedure with potentially fewer side effects

: for people. However, further investigation is necessary to validate this method for use in clinical
Or do dogs sense parasites practice.

which cause the tumors?

Hollywood coincidence or truth disguised as fiction? LINK
Why do jews [really] hate dogs?

105

SCIENCE пот HEED -a

ft News Space& Physics Health РізпегЕапһ — StrangeNews Animals History | Forums

7 Strange Facts about the 'Mind-Control' Parasite Toxoplasma Gondii

By Stephanie Buck October 18, 2016
К " Source: https:/www livescience.com'56529-strange-facts-about-toxoplasme-gondil-parasite html
Can a parasite control your mind?

A single-cell parasite, Toxoplasma допаї is perhaps best-known for its connection to cats. The parasite can move from its feline host to humans, most commonly
through contact with cat feces. And while the parasite typically only causes mild Infection (people may have flulike symptoms), in people with weakened Immune
systems, infections can cause serious problems, from seizures to severe lung problems.

But a Т. gondil infection can also have some downright bizarre effects. Over the years, the parasite has not only surprised and stumped researchers, but has also led to
new insights into how human behaviors work.

T. gondii has been shown to increase fearlessness in rats.

Rats infected with the parasite seem to lose their typical fear of cats, and more specifically, their fear of cat urine. A 2011 study in PLOS ONE suggested that infected rats
start to feel a type off'sexual attraction ]to the smell of cat urine, rather than their usual defensive response to the scent.

This might be because a Т. gondii infection changes neural activity in certain areas of the brain, the researchers said. The parasite “averwhelms the innate fear
response" so that rats no longer avoid the scent of cat urine, they wrote. Instead, the amorous rats are drawn to it — and to their deaths.

T. gondii can leap between almost all warm-blooded animals.

Cats and rats aren't the only animals that can host the parasite. T. gondijis an exceptional parasite in that it can leap from almost any warm-blooded creature to

another. Although an estimated 6 in cf 10 infectious human diseases are zoonotic (meaning they can hop from animals to humans), hardly any share 7. gondi/s wide
versatility of host organisms, according to the Centers for Disease Control and Prevention.

Scientists havent pinpointed exactly why this is, but some research, such as a 2011 study published in the Proceedings of the National Academy of Sciences, suggests
that at least part of the answer may be found in the parasite's proteins: When a certain type of protein is removed, the parasite is no longer virulent, Researchers
speculate that this is because those proteins disrupt key proteins in the host's cell that are key to the host's immune response.

Others suggest that T. gondii could contribute to other types of mental illness, even suicide.
Schizophrenia isn't the only psychological disorder that is possibly linked to T. gondii. А 2011 study that was done in mice and published in the journal PLOS ONE

owed that the parasitemay cause infected brain cells to release high levels of the neurotransmitter dopamine.

Increases in doparninefould play a hand in certain mood disorders, such as bipolar diseaseJwhiclt has been linked to dopamine irregularities, according to the study.

Other research done in humans suggests that Toxoplasma could be connected to impulsivity, and even suicide.

The parasite wouldn't be the first pathogen to alter people's brain and behavior: The rabies virus, which is deadly in people, has long been shown to have devastating
neurological effects.

Some studies suggest that|T. gondii is linked to schizophrenia.

One of Toxoplasm4's most frightening — and most controversial— possible effects is its impact on the mind. If a woman is infected with the parasite while she is
pregnant, her fetus may be at risk for developing schizophrenia and other mental disorders, according to a 2006 study of people living in ark, published in the.
journal Biological Psychiatry.

And that's notall. A 2014 study that was published in The Journal of Nervous and Mental Disease f in patients with schizophrenia, providing
further evidence for a potential link between the parasite and the mental illness.

T. gondii has no cure.
There are no medications available to treat T. gondii, Other than remaining vigilant to try to prevent infection, there's not too much else to do.

Іп a 2005 study in the American Journal of Obstetrics and Gynecology, health care providers advised pregnant women and women looking to become pregnant to get
screened for T. gondii. Тһе authors also suggested that women understand the risk factors for infection, such as exposure to cats (and particularly litter boxes and
feces), consuming improperly cooked meat and drinking untreated water.

Up to half of the world may be infected.
Researchers can't seem to agree on just how widespread T gondiiis, in part because many cases may go unreported. A 2002 study in the journal Clinical Microbiology

id Infection estimated that between 16 to 40 percent of people worldwide are infected, but in certain regions, such as parts of Central America, South America and
continental Europe, the rates are between 50 to 80 percent.

A 2011 study in the Journal of Glabal Infectious Diseasesgave a much higher estimate of the numbers of people infected: about 6 billion people worldwide, or more than
80 percent of the world.

The Centers for Disease Control and Prevention estimates that about 60 million people in the United states — or nearly 20 percent — are infected. A simple blood te:
can determine whether you have T. gondii antibodies, which indicate infection with the parasite. [7 Absolutely Horrible Head Infections]

Most of the time, T. gondii has no symptoms.

Though T. gondii can cause flulike symptoms in mild cases, a 2014 study in the American Journal of Tropical Medicine and Hygienesuggested that in the vast majority of
cases, people experience only mild symptoms, or по symptoms at all. Indeed, this may be why the parasite has been largely neglected by researchers, the authors
Wrote.

The parasite is most dangerous to those with preexisting conditions, such as diseases that contribute to a suppressed immune system. But most people infected with T.
gondii wil never even know they have it

Rabbi Fears Genetic Studies Will

Show That Jews Carry Genes That
Are Polluting The World'

FEBRUARY 20, 2020 By СЕТТЕАМ — 11 COMMENTS

Because of the statistically high incidence of[schizophrenia] land Pipolar disorder] disorder|in the Jewish

Ashkenazi community, there have been several ongoing medical studies requesting volunteers to

help scientists better understand the biological basis of these condition:

Homosexuality and Judaism
From Wikipedia, the free encyclopedia

"LGBT topics and Judaism" redirects here. For transgender topics in Judaism, see Transgender people and religion § Judaism.

The subject of homosexuality and Judaism dates back to the Torah. The book of Vayikra (Leviticus) is traditionally regarded as
Classifying sexual intercourse between males as а foelvan (something abnorred or detested) that can be subject to captal
punishment by the currently non-existent Sanhedrin under halakha (Jewish law)

The issue has been a subject of contention within modem Jewish denominations, and has led to debate and division. Traditionally.
Judaism has understood homosexual male intercourse as contrary to Judaism, and this opinion is still maintained by Orthodox
Judaism.

On the other hanc, Reconstructionist Judaism and Reform Judaism do not hold this view, and allow both homosexual intercourse
and same-sex marriage. Conservative Judaism's Committee on Jewish Law and Standards, which until December 2006 held the
зате position as Orthodoxy, has since issued multiple opinions under its phiosophy of pluralism; one opinion continues to follow the
Orthodox position while another opinion substantially liberalizes the view of homosexual sex and relationships (while continuing to
regard certain sexual acts as prohibited).

gayest city on earth

QAI images News |) Videos Q Shopping + More

About 760,000 results (0.71 seconds)

Tel Aviv

Tel Aviv Pride Parade is widely recognized as one of the leading parades in the world, with
The Boston Globe dubbing Tel Aviv “the World's Gayest City” and Out Magazine calling it
“the Gay Capital of the Middle East.” Jun9.2017

htips://mfa.gov.il» israelexperience» lifestyle» pages» те... +
Tel Aviv hosts largest gay parade ever held in the Middle East

(О Anonymous (1D: QUEENS) 55 07/01/24 (Thu)17-50:55 No 328373101 » zsszsszaosz
File: say eus png (181 KB, 7404749)

Sexual Orientation and Behavior of Adult Jews in
Israel and the Association With Risk Behavior

Zohar Mor 1, Udi Davidovich 2

Affiliations 4- expand
PMID: 26754157 DOI: 10.1007/510508-015-0631-0

Abstract

Estimating the size of key risk groups susceptible to HIV/sexually transmitted diseases (STI) is
necessary for establishment of interventions and budget allocation. This study aimed to identify
various dimensions of sexual orientation and practices in Israel, and correlate the findings with
sexual risk behavior (SRB). It used a random representative sample of the Jewish population aged
18-44 years who completed online questionnaires regarding their self-identified sexual orientation,
attraction and practices, and SRB. Concordant heterosexuals were those who self-reported
heterosexual identity, were attracted and had sex only with the opposite gender. National
estimates regarding prevalence of gay, lesbian, and bisexual men and women were based onthe
civil census. The sample included 997 men and 1005 women, of whom 11.3 and 15.2 % were
attracted to the same-gender, 0.2 ond 0.7 % reported lifetime same-gender encounter while 02
and 48 % self-identified as gay or bisexual men and lesbian or bisexual women, respectively. The
‘estimated population of self-identified Jewish gay or bisexual men and lesbian or bisexual women
aged 18-44 in Israel was 94,176, and 57,671, respectively. SRB was more common among self-
identified gays or bisexual men and among discordant heterosexual men and women. Those who
reported same-gender sexual practices reported greater SRB than those who only had opposite-
gender encounters. interestingly, SRB among discordant heterosexuals was associated with same-
sex behavior rather than attraction. Health practitioners should increase their awareness of sexual
diversity among their clientele, and should recognize that risk For HIV/STI may exist among self-
identified heterosexuals, who may not disclose their actual sexual attraction or practices.
Keywords: Bisexual; Gay men; Israel; Lesbians; Sexual orientation.

Around 10% or awen mates are romosexual.

The jewish community is rife үйін homosexuality.

‘Aico koop in mind that Talmudic judaism beliavoc that god doocn' have any gendor. That god raprosonts the urion of

male and female. They even havea name forthe female aspect of god called Shekhinah. They also believe that Atam

was noi the frst human, but was created beside a female caled Lith.

https:/en.wikipedia org/vikiShekhineh.

They belleve tnat untying tne sexes s getting cicser to god. That's probably the root cause oll ins transgenderism stu.

Not Anudda Shoah!

It gets worse.

106

W: LIKE TO THINK Of ourselves as in the driver’s seat, choosing where to go,

whether to speed up or slow down, when to switch lanes. We make the decisions
and bear the consequences. This is a convenient, even necessary belief. If we
jettison the notion of free will, the laws that hold people accountable for their
actions begin to crumble. The world becomes an unruly or even terrifying place.

Alien beings that turn us into zombies, bloodthirsty vampires, and sex-crazed La sz
robots are standard sci-fi fare precisely because they evoke the horror of losing
control or, worse, becoming slaves to creatures bent on exploiting us for their

own gain. So it’s disconcerting to think that an invisible passenger might also
have a hand on the steering wheel, vying to move us in one direction when we’d 2 4 (YU
rather go another. When we let up on the accelerator, an unseen foot presses f ES 0 N
harder. | )

Parasites are like that invisible passenger. Adept at outwitting our immune | A
systems, they sneak aboard our bodies and then the devilry begins. They cause
rashes, lesions, aches, and pain. They eat us from the inside out; use us to
incubate their young; sap our energy; blind, poison, maim, and sometimes kill , РГ (
us. But that’s not the full extent of their clout. Some parasites have another trick / ү
up their sleeves—an awesome hidden power that astounds and confounds even
scientists who study them for a living. Simply stated, these parasites are masters
of mind control. Whether as tiny as a virus or as big as a six-foot-long
tapeworm, they have found all kinds of devious methods to manipulate the How Tiny Creatures Manipulate
behavior of their hosts, and that includes, many researchers now strongly

ерес Bamans. Our Behavior and Shape Society

and then the devilry begins

Devil1

devilry "€

Devil3

Devil4

What are [devils]?
Are parasites devils?

Anonymous (ID: 6 Ey) = 09/27/21(М0п)18:39:06 No.341161329 » >>341161567
: 320px-Lambton Worm.jpg (68 KB, 320x465)

=

Be >-341160425
>Lambton worm
>https://en.wikipedia.org/wiki/Lambton_Worm
>The story states that the young John Lambton was a rebellious character who missed church one Sunday to go fishing in the River Wear. In many versions of the story, while

walking to the river, or setting up his equipment, John receives warnings from an old man (or a witch — depending on who tells the story) that no good can come from missing church.

>John Lambton does not catch anything until the church service finishes, at which point he fishes out a small eel- or lamprey-like creature with nine holes on each side of its
salamander-like head. Depending on the version of the story, the worm is no bigger than a thumb, or about 3 feet (90 centimetres) long. In some renditions it has legs, while in others
it is said to more closely resemble a snake.

>At this point, the old man returns, although in some versions it is a different character. John declares that he has "catched [caught] the devil" and decides to dispose of his catch by discarding it

down a nearby well. The old man then issues further warnings about the nature of the beast.

Holy shit

https://en.wikipedia.org/wiki/Lindworm

107

Could the word ‘devil’ be replaced with the word ‘parasite’ in all of the following verses without losing context?

Mat 9:32

Mat 9:33

Mat 11:18

Mat 12:22

Mat 15:22

Mat 17:18

Mar 5:15

Mar 5:16

Mar 5:18

Mar 7:26

Mar 7:29

Mar 7:30

Luk 4:33

Luk 4:35

Luk 7:33

Luk 8:29

Jhn 8:48

As they went out, behold, they brought to him a dumb
man possessed with a devil.

And when the devil was cast out, the dumb spake: and
the multitudes marvelled, saying. It was never so seen in
Israel.

For John came neither eating nor drinking, and they say,
He hath a d

Then was brought unto him one possessed with a devil,
blind, and dumb: and he healed him, insomuch that the
blind and dumb both spake and saw.

And, behold, a woman of Canaan came out of the same
coasts, and cried unto him, saying, Have mercy on me, O
Lord, thou Son of David; my daughter is grievously vexed
with a devil.

And Jesus rebuked the devil; and he departed out of him:
and the child was cured from that very hour.

And they come to Jesus, and see him that was possessed
with the devil, and had the legion, sitting, and clothed,
and in his right mind: and they were afraid.

And they that saw it told them how it befell to him that was
possessed with the devil, and а/о concerning the swine.

And when he was come into the ship, he that had been
possessed with the devil prayed him that he might be with
him.

The woman was a Greek, a Syrophenician by nation; and
she besought him that he would cast forth the devil out of
her daughter.

And he said unto her, For this saying go thy way; the devil
is gone out of thy daughter.

And when she was come to her house, she found the

And in the synagogue there was a man, which had a spirit
of an unclean devil, and cried out with a loud voice,

And Jesus rebuked him, saying, Hold thy peace, and
come out of him. And when the devil had thrown him in
the midst, he came out of him, and hurt him not.

For John the Baptist came neither eating bread nor
drinking wine; and ye say, He hath a devil.

(For he had commanded the unclean spirit to come out of
the man. For oftentimes it had caught him: and he was
kept bound with chains and in fetters; and he brake the
bands, and was driven of the devil into the wilderness.)

Then answered the Jews, and said unto him, Say we not
well that thou art a Samaritan, and hast a devil?

Jhn 8:49

Jhn 8:52

Jhn 10:20

Jhn 10:21

Jhn 13:2

Act 13:10

Eph 4:27

Eph 6:11

Heb 2:14

Jas 4:7

1Pe 5:8

1Jo 3:8

1Jo 3:10

Luk 9:42

Luk 11:14

Jhn 7:20

108

Jesus answered, | have not a devil; but | honour my
Father, and ye do dishonour me.

Then said the Jews unto him, Now we know that thou hast
a devil. Abraham is dead, and the prophets; and thou
sayest, If a man keep my saying, he shall never taste of
death.

And many of them said, He hath a devil, and is mad; why
hear ye him?

Others said, These are not the words of him that hath a
devil. Can a devil open the eyes of the blind?

having now put into
S son, to betray him;

And supper being ended, the d
the heart of Judas Iscariot, Sim

And said, O full of all subtilty and all mischief, thou child of
the devil, thou enemy of all righteousness, wilt thou not
cease to pervert the right ways of the Lord?

Neither give place to the devil.

Put on the whole armour of God, that ye may be able to

Forasmuch then as the children are partakers of flesh and
blood, he also himself likewise took part of the same; that
through death he might destroy him that had the power of
death, that is, the devil;

Submit yourselves therefore to God. Resist the devil, and
he will flee from you.

Be sober, be vigilant; because your adversary the devil,
as a roaring lion, walketh about, seeking whom he may
devour:

He that committeth sin is of the devil; for the devil sinneth
from the beginning. For this purpose the Son of God was

In this the children of God are manifest, and the children
of the devil: whosoever doeth not righteousness is not of
God, neither he that loveth not his brother.

And as he was yet a coming, the devil threw him down,
and tare him. And Jesus rebuked the unclean spirit, and
healed the child, and delivered him again to his father.

And he was casting out a devil, and it was dumb. And it
came to pass, when the devil was gone out, the dumb
spake; and the people wondered.

The people answered and said, Thou hast a devil: who
goeth about to kill thee?

What are [demons]? [devil = demon]
In ancient times, what were [parasites] called?

Are demons considered clean or [unclean]?
Are parasites considered clean or [unclean]?

Do demons get inside of your body?
Do parasites get inside of your body?

Do demons manipulate your behavior?
Do parasites manipulate your behavior?

Do demons take possession of your body?
Do parasites take possession of your body?

Does fasting “cast out demons”? (M17.21)
Does fasting “cast out parasites”?

Do demons try to make you commit suicide?
Do parasites try to make you commit suicide?

Do Old Testament Laws prevent possession from demons?
Do Old Testament Laws prevent possession from parasites?

Why do the infected use ‘they/them’ as pronouns?

Who is the Gerasene demoniac? (L8.32)

["My name is Legion, for we are many"]

After the worms were exercised, what did they infect next?
Will parasites kill the host in order to continue its life-cycle?
Do worms have a history of drowning their hosts?

Spinochordodes tellinii

Spinochordodes tellinii is a parasitic nematomorph hairworm whose larvae develop in
grasshoppers and crickets. This parasite is able to influence its host's behavior: once
the parasite is grown, it causes its grasshopper host where the
grasshopper will likely drown.

Family: Chordodidae
Genus: Spinochordodes
Kingdom: Animalia
Species: S. tellinii

What happened to the swine?

Were the pigs possessed by demons?

Or were the pigs possessed by parasites?

Is the word 'parasite' synonymous with the word 'demon'?
109

Got a little out of my comfort zone and wore an
outfit that had been hiding in my closet for a year.
It was so much fun <2

Ф Bean ses?
(they/them xe/xem)

ID in captions

Could a demon be "cast out" of a host by administering anti-parasite treatments?

"Seek, therefore, a large trailing gourd, having a stalk the length of a man; take
out its inwards and fill it with water from the river which the sun has warmed.
Hang it upon the branch of a tree, and kneel upon the ground before the angel of
water, and suffer the end of the stalk of the trailing gourd to enter your hinder
parts, that the water may flow through all your bowels. Afterwards rest kneeling
on the ground before the angel of water and pray to the living God that he will
forgive you all your past sins, and pray the angel of water that he will free your
body from every uncleanness and disease. Then let the water run out from your
body, that it may carry away from within it all the unclean and evil-smelling
things of Satan. And you shall see with your eyes and smell with your nose all
the abominations, and uncleannesses which defiled the temple of your body;
even all the sins which abode in your body, tormenting you with all manner of
pains. I tell you truly, baptism with water frees you from all of these. Renew your
baptizing with water on every day of your fast, till the day when you see that the
water which flows out of you is as pure as the river's foam. Then betake your
body to the coursing river, and there in the arms of the angel of water render
thanks to the living God that he has freed you from your sins. And this holy
baptizing by the angel of water is: Rebirth unto the new life. For your eyes shall
henceforth see, and your ears shall hear. Sin no more, therefore, after your
baptism, that the angels of air and of water may eternally abide in you and serve

D "- HELF QUICKNAY арм. OPTIONS мер
BLUE LETTER BIBLE |
an Verse or Word(s) La CLICK TO CHANGE

Pf ~
« < Y > » "coPY COPYOPTIONS E STRONG'S FORMAT BY: & VERSE (Х/ PARAGRA

Rom 7:20 Now if | do that | would not, it is no more | that do it, but
sin that dwelleth in me.

Does sin "live" inside the body?
Is the word 'sin' and the word 'parasite' synonymous?

Q & kingjamesbibleonline.org/2-Maccabees-Chapter-9/

9 бо that the worms rose ир out of the body of this wicked man, and
whiles he lived in sorrow and pain, his flesh fell away, and the

filthiness of his smell was noisome to all his army.
2 Maccabees 9:9 KJV verse detail

110

Do worms come from hell? Mar 9:47 And if thine eye offend thee, pluck it out: it is better for
thee to enter into the kingdom of God with one eye, than
having two eyes to be cast into hell fire:

Do demons come from hell?
Is hell underground?
Do worms come from underground? Mar 9:48 Where their worm dieth not, and the fire is not quenched

Іп 2012, in response to Günter Grass's poem "Was gesagt werden muss" ("What Must Be Said") which criticized Israel's nuclear weapons program, Israeli poet and
Holocaust survivor Itamar Yaoz-Kest published a poem entitled "The Right to Exist: a Poem-Letter to the German Author" which addresses Grass by name. It contains
Е If you force us yet again to descend from the face of the Earth to the depths of the Earth — let the Earth roll toward the Nothingness." INTE Tae
journalist Gil Ronen saw this poem as referring to the Samson Option, which he described as the strategy of using Israel's nuclear weapons, "taking out Israel's
enemies with it, possibly causing irreparable damage to the entire world."[34]

Why would a jew [an infected] claim he does not want to return to 'underground'? [depths of the Earth]

Do worms come from underground?
What did the ancient Greeks call the 'underground'?

Who is Yaldabaoth?

What is Sheol? |

It gets worse.

111

HELP QUICKNAY ADY. OPTIONS KJV
BLUE LETTER BIBLE Trl
ата Мегзе ог Word(s) км. ІРІ CLICK TO CHANG!

COPY COPY OPTIONS E STRONG'S Ш RED-ETI

сеп 3:14 And the LORD God said unto the serpent, Because thou
hast done this, thou art cursed above all cattle, and above
every beast of the field: upon thy belly shalt thou go, and

Do serpents eat dust?

[Dust of the Earth = dirt]

Do serpents eat dirt or do worms eat dirt?

Can the Latin term 'serpens' be translated into the English terms ‘snake’, 'dragon' ог 'WORM'?
Is the Serpent from Genesis actually a worm?

a" ре ere HELP QUICKNAY ADY. OPTIONS pus
Lodi it cia mms KN.
« < ¥ > » СОРУ COPY OPTIONS Ш STRONG'S FORMAT BY: «Әуезе (OJ PARAGR)

Lev 15:19 ‘| And if a woman have an issue, and her issue in her flesh

be blood, she shall be put apart seven days: and
whosoever toucheth her shall be unclean until the even.

Why does the Bible consider menstruation to be unclean?
Can [unclean] parasites be transmitted through blood?

Why does the Bible consider nocturnal ejaculations and sex to be unclean?
Can [unclean] parasites be transmitted through semen?

o тт HELP QUICKNAY ADY. OPTIONS Im
JE LETTE IBLE ;
a» runc CO KIV,

7» =
« < ¥ > » COPY COPYOPTIONS Ш STRONG'S FORMATBY: Verse (©) PARAGI

Deu 23:10 If there be among you апу man, that is not clean by
reason of uncleanness that chanceth him by night, then
shall he go abroad out of the camp, he shall not come
within the camp:

Deu 23:11 But it shall be, when evening cometh оп, he shall wash
himself with water: and when the sun is down, he shall
come into the camp again.

m en HELF QUICKNAY ADY. OPTIONS T—
BLUE LETTER BIBLE >
жа. ку · асое

« < V > » COPY COPYOPTIONS Ш STRONG'S ҒОВМАТВҮ: @/VERSE (C)PARAG

Lev 15:18 The woman also with whom man shall lie with seed of
copulation, they shall both bathe themselves in water,
and be unclean until the even.

112

Why does the Bible consider pork and shellfish to be unclean?
Are pork and shellfish notorious parasite vectors?

жа BLUE LETTER BIBLE = pape Ter | ІРІ KJV

CLICK TO CHAN

« < Y > » ЯСОРҮ COPYOPTIONS Ш STRONG'S FORMAT BY: NERSE (S) PARAC

Lev 11:7 And the swine, though he divide the hoof, and be
clovenfooted, yet he cheweth not the cud; he is unclean
to you.

HELF QUICKNAY ADY. OPTIONS
A BLUE LETTER BIBLE 3 KJV

Verse or Word(s KJV >» CLICK TO CHAN /

4 < ҰЯ» » COPY COPYOPTIONS Ш STRONG'S FORMATBY. Q/VERSE (S) PARAC iN Nh 7

Lev11:12 Whatsoever hath no fins nor scales in the waters, that
shall be an abomination unto you.

Body riddled with parasites as a result of eating raw pork for 10 years.

Why does the Bible say sodomy is an abomination?
Are homosexuals riddled with parasites?
Is anal sex one of the most common methods of parasitic infection?

ums
ж

m Е 4 HELP QUICKNAY ADY. OPTIONS ж.
ЫН... |с |Б

4 < y > » cor COPYOPTIONS M STRONG'S FORMATBY. QJ VERSE (©) PARAG

Lev 18:22 Thou shalt not lie with mankind, as with womankind: it /s
abomination.

What does the Bible say about drinking blood?
Does consuming blood transfer parasites?

m HELF QUICKNAY ADY OPTIONS

ae BLUE LETTER BIBLE нини ІРІ KJV

CLICK TO CHANI

4 < Ж > » соғу COPYOPTIONS Ш STRONG'S FORMATBY. © VERSE [S) PARAG

Lev 17:10 ! And whatsoever man there be of the house of Israel, or
of the strangers that sojourn among you, that eateth any
manner of blood; | will even set my face against that soul
that eateth blood, and will cut him off from among his
people.

Are some yeasts considered to be parasites?

Anonymous ID:woIY6ACk Sat 12 Oct 2019 23:07:53 No.229679032

22229659291
Beware the yeast of the pharasies

113

Why did the Bible consider mildew to be unclean?
Is mildew a parasite?

Leviticus 14

33 The LORD said to Moses and Aaron, 34 “When you enter the land of Canaan, which I am giving you as your possession, and | put a spreading
mildew in a house in that land, 35 the owner of the house must go and tell the priest, 1 have seen something that looks like mildew in my house.’ 36
The priest is to order the house to be emptied before he goes in to examine the mildew, so that nothing in the house will be pronounced unclean. After
this the priest is to go in and inspect the house. 37 He is to examine the mildew on the walls, and if it has greenish or reddish depressions that appear
to be deeper than the surface of the wall, 38 the priest shall go out the doorway of the house and close it up for seven days. 39 On the seventh day
the priest shall return to inspect the house. If the mildew has spread on the walls, 40 he is to order that the contaminated stones be torn out and
thrown into an unclean place outside the town. 41 He must have all the inside walls of the house scraped and the material that is scraped off dumped
into an unclean place outside the town. 42 Then they are to take other stones to replace these and take new clay and plaster the house.

43 "If the mildew reappears in the house after the stones have been torn out and the house scraped and plastered, 44 the priest is to go and examine

it and, if the mildew has spread in the house, it is a destructive mildew; the house is unclean. 45 It must be torn down—its stones, timbers and all the
plaster—and taken out of the town to an unclean place.

46 "Anyone who goes into the house while it is closed up will be unclean till evening. 47 Anyone who sleeps or eats in the house must wash his
clothes."

Job 2:7. 1 So went Satan forth from the presence of the LORD, and
smote Job with sore boils from the sole of his foot unto
his crown.

Job 7:5 My flesh is clothed with worms and clods of dust; my skin
is broken, and become loathsome.

Are animals considered spoils of war?

So why would God command Saul to kill all of the animals of the Amalekites?
Were the Amalekites a nation of sorcerers?

Is magic associated with parasites?

If the Amalekites and their animals were infected, would God's command make complete sense?

m 7 22 z AD NS "X
aa BLU E LETTER BIBLE Verse or Word(s) ІРІ KJV

CLICK TO CHAN(

« < ¥ > » E COPY COPYOPTIONS Ш STRONG'S FORMATBY: Wrerse (© PARAG

1Sa 15:3 Now go and smite Amalek, and utterly destroy all that
they have, and spare them not; but slay both man and

woman, infant and suckling, ox and sheep, camel and
ass.

114

And Jesus milked an ewe which was feeding among the grass. And he put the
milk upon the sand made hot by the sun, saying: "Lo, the power of the angel of
water has entered this milk. And now the power of the angel of sunshine will
enter it also."

And the milk became hot by the strength of the sun.
"And now the angels of water and of sun will join with the angel of air."
And lo, the vapor of the hot milk began to rise slowly into the air.

"Come and breathe in by your mouth the strength of the angels of water, of
sunshine, and of air, that it may come into your body and cast out the Satan from
you."

And the sick man whom Satan tormented did breathe within himself, deeply, the
rising whitish vapor.

"Straightway will Satan leave your body, since for three days he starves and
finds no food within you. He will come out of you to satisfy his hunger by the
hot steaming milk, for this food finds favor in his sight. He will smell its smell,
and will not be able to resist the hunger which has tormented him three days
already. But the Son of Man will destroy his body, that he may torment none else
again."

Then the sick man's body was seized with an ague, and he retched as though he
would vomit, but he could not. And he gasped for air, for his breath was spent.
And he fainted on the lap of Jesus.

"Now does Satan leave his body. See him." And Jesus pointed to the sick man's
opened mouth.

And then they all saw with astonishment and terror that Satan was coming out
from his mouth in the shape of an abominable worm, straight towards the
steaming milk. Then Jesus took two sharp stones in his hands and crushed the
head of Satan, and drew out from the sick man all the body of the monster which
was almost as long as the man. When the abominable worm came out of the sick

"For I tell you truly, evils and dangers innumerable lie in wait for the Sons of Men. Beelzebub, the prince of all devils, the source of every evil, lies in wait
in the body of all the Sons of Men. He is death, the lord of every plague, and taking upon him a pleasing raiment, he tempts and entices the Sons of Men.
Riches does he promise, and power, and splendid palaces, and garments of gold and silver, and a multitude of servants, all these; he promises renown and
glory, fornication and lustfulness, gluttony and wine-bibbing, riotous living, and slothfulness and idle days. And he entices every one by that to which their
heart is most inclined. And in the day that the Sons of Men have already become the slaves of all these vanities and abominations, then in payment thereof
he snatches from the Sons of Men all those things which the Earthly Mother gave them so abundantly. He takes from them their breath, their blood, their
bone, their flesh, their bowels, their eyes and their ears. And the breath of the Son of Man becomes short and stifled, full of pain and evil-smelling, like the
breath of unclean beasts. And his blood becomes thick and evil-smelling, like the water of the swamps; it clots and blackens, like the night of death. And
his bone becomes hard and knotted; it melts away within and breaks asunder, as a stone falling down upon a rock. And his flesh waxes fat and watery; it
rots and putrefies, with scabs and boils that are an abomination.

And his bowels become full with abominable filthiness, with oozing streams of decay: and i i have their habitation there.
And his eyes grow dim, till dark night enshrouds them, and his ears become stopped. like f all shall the erring Son of
Man lose life. For he kept not the laws of his Mother, and added sin to sin. Therefore, are taken from him all the gifts of the Earthly Mother: breath, blood,
bone. flesh, bowels, eyes and ears, and after all else, life, with which the Earthly Mother crowned his body.

115

Protocol master 03/12/22(Sat)13:23:22 Мо.31249983 LJ
b: 3982437435 ае4с064е88 b.jpg (149 KB, 1024x683)

>>31249889
>No need to get defensive
The devil prowls around like a lion, looking for people to devour.

They go on these threads and lie constantly to keep people in the cycle of fear, uncertainty, and
doubt. Doubt, is without doubt, their greatest weapon.

But the time is coming where there can be no more doubt. The wheat is being separated from the chaff and the lukewarm
in spirit will be cast into the fire alongside the chaff.

>| was practically an atheist before cleansing
The black goo and the parasites are demonic in nature. They suppress spirituality. Fill your thoughts with darkness, and
torture you. They incite you to sin and make you feel iredeemable when you give in.

Sin, of which, is only such a strong temptation because of the inner uncleanness. These parasites are literal demons.

People need to know the truth, even if most choose to reject it. Not many will do what it takes. Water fasting is challenging.
Doing coffee enemas appears emasculating. Taking a mineral powder sounds like woo-woo.

Now what if | told you all three of these thoughts are demonic in nature? The parasites are intelligent. They fear their
annihilation and can alter your perception to keep you in a cycle of misery. Many people you meet are, in fact, possessed

If parasites are literal demons, and if parasites can enter a host through sex, and if parasites can take
years before they seize control over a host, and if your wife was not a virgin when you met her, then
could the following horror story not only be possible, but also quite commonplace:

СА Steve

Horror story concept: you fall in love
with a woman, get married, and
have a son. Shortly following your

son's eighth birthday, your wife is
replaced by a demon who
impersonates her appearance and
mannerisms perfectly, except now
she wants to turn your son into а

girl.

Forty-nine days

— How long did the Buddha fast? forty-nine days The Buddha seated under the
HELF uic v À n

| BLUE LETTER BIBLE — ee Rajayatana tree had been fasting for forty-nine days by then. They brought rice cakes

ER and honey to help him break his fast.

« < Y > » СОР COPYOPTIONS Ш STRONG'S FORMAT BY: < vensE (SN) PARAC

Then was Jesus led up of the Spirit into the wilderness to
be tempted of the devil.

Mat 4:2 And when he had fasted forty days and forty nights, he
was afterward an hungred.

22229657155
I've put serious thought into this in the past. In the bible it is written that (paraphrasing) "Jesus went out into the wilderness for 40 days during which
time he did not eat for the entire 40 days in order to do cast satan out" Starving oneself is a very old method of dealing with parasites. If you arent

eating food then the parasites dont get to eat either and it comes down to they die out or you do.

116

Did the ancient Chinese believe that parasites are demons?
What are Gu Demons? LINK
What is a wetiko?

THE Wetiko is more accurately described as simply Wetiko.

Like a trans-dimensional plague, It is simultaneously my personal
tormentor and a metaphysical virus that has spread around the

world..infecting and feeding upon most, if not all, human beings

alive today.

Three Corpses

From Wikipedia, the free encyclopedia

The sanshi =P "Three Corpses" or sanchong = "Three Worms" аге a Daoist physiological
belief that demonic creatures live inside the human body, and they seek to hasten the death of their
host. These three supernatural parasites allegedly enter the person at birth, and reside in the

three dantian "energy centers", respectively located within the head, chest, and abdomen.

After their human host dies, they are freed from the body and become malevolent ghosts.

The pernicious Three Corpses/Worms work to harm their host's health and fate by initiating
Sicknesses, inviting other disease-causing agents into the body, and reporting their host's
transgressions to the gods. The Three Corpses are supposed to keep records of their host's
misdeeds, ascend to tian "heaven" bimonthly on the night of Chinese sexagenary gengshen AQ
Æ "57th of the 60-day cycle" while the host is sleeping, and file reports to the Siming 2195 ( T
"Director of Destinies" who deducts a certain number of days from the person's life for each lf. N
misdeed. One way of avoiding this bureaucratic snitching is to stay awake for the entire 55%
gengshen day and night, thus preventing the Three Corpses from leaving one's body (a belief

- : cee Ва Sanshi =P "Three Corpses” illustration from the 5
later assimilated into the Japanese Koshin BF tradition). ja

(c. 9th century) Chu sanshi jiuchong baoshengjing E&
For a Daoist adept to achieve the longevity of a xian "transcendent; immortal", it was ЕРЛӘНЕ

necessary to expel the Three Corpses from the body. Since these evil spirits feed upon

decaying matter produced by grains being digested in the intestines, the practice of bigu “abstinence from grains and cereals" is the first step
towards expelling them. Bigu alone will not eliminate the Three Corpses, but weakens them to the point where they can be killed with waidan

alchemical drugs such as cinnabar, and ultimately eliminated through neidan meditation techniques.
pu A" Food Pyramid

“Since these evil spirits feed upon decaying matter produced by grains..." Fin, voguna cheese —— Neat, EN
нА ( Б
2-3 Servings

Vegetable Group y 3. Fruits Group

grains => |

* A feeling of pressure in the head, chronic migraine type headaches, weakened vision, poor hearing, unusual phantom

Peng Ju Possession Symptoms

smells and tastes, blotches and abnormalities upon the skin of the face, excessive amounts of mucous or spontaneous
flowing of fluid from the eyes, bad breath

Peng Jiao Possession Symptoms

* Digestive issues, weakness in the back and knees which limits mobility, weakness and cold in the lower abdomen due to
damage to the lower Dan Tien, nocturnal emissions, excessive feelings of desire and lust, addictive behaviors

Peng Zhi Possession Symptoms

e Pain and swelling in the chest and hypochondriac region of the body, shortness of breath, spasms in the body, an
obsession with sensual pleasures, depression, suicidal tendencies
117

The location of the three worms also corresponds to three key locations upon the body which practitioners of alchemical
meditation will be more than familiar with. These locations are known as the three of the key ‘clipping passes’; areas of
difficulty for those involved in Daoist meditation.

The Peng Zhu clipping

pass known as Yu Zhen ^

The Peng Zhi clipping -
pass known as Shen Dao

Pineal gland

Pituitary gland

Visudha EA х- as Thyroid gland

The Peng Jiao clipping

pass is within the sacrum Anahata chakra (Heart) Thymus gland
Manipurana chakra (pancreas) Adrenal gland
Swadhisthana chakra (Testis & ovary) ы “ Gonads gland

What are Chakras? Muladhara chakra Prostate &
Chakras? = Glands? (Grounding & physical stemina) ^ Fallopian tube

Do parasites harvest gland secretions?
By controlling human gland secretions, can a parasite control the human?
Why does the worm coil up the kundalini?

What is the Caduceus?

COSMIC ENERGY ENTRY COSMIC ENERGY INPUT
(FEMALE) (MALE)

vampire channel

Entities with a trunk B
and suckars

Snail with

organs of the hola

Field parasites
on and

under legs

G6 “There are beings in the spiritual realms for whom anxiety and fear
emanating from human beings offer welcome food. When humans have
no anxiety and fear, then these creatures starve... If fear and anxiety
radiates from people and they break out in panic, then these creatures
find welcome nutrition and they become more and more powerful.
These beings are hostile towards humanity.

118

Hollywood has convinced you that demons have claws, horns, fangs, poison, and look like this:

But do demons actually look like this:

...Well, ummm, for once, | guess Hollywood’s
depiction was actually very accurate.

Cat-Demon takes possession of a man
by inserting worm into man’s anus

130 Detail of man
near the top of the

% decorative column
mentioned in the caption
for Figure 129, showing
how the demonic tendril
is inserted into the
man's anus

The tendron from the demonic terminates in the
body of the human figure.

Do parasites feed on human blood?
What does pop culture mean by this:

"You're up my anus"
"| drink their blood." LINK

Osculum infame

From Wikipedia, the free encyclopedia

Osculum infame is the
name of a witch's supposed
ritual greeting upon meeting
with the Devil. The name
means The Shameful Kiss,
or The Kiss of Shame since

it involved kissing the devil's
anus, his other mouth.

According to folklore, it was

a 9 і Тһе osculum infame illustrated іп
this kiss that allowed the Francesco Mana GUazzo's
Devil to seduce women. Compendium maleficarum of 1608

The pamphlet provided the first descriptions of the osculum infame to
the English population?! Belief held that the Devil demanded the
kiss of shame in forms other than human, including rams, black cats,
and toads. Errores Haereticorum, a medieval tract, claims that the

131 The role could also be Why do witches have black cats?

reversed whereby the witch was the recipient of the kiss.!5] What is Toxoplasmosis?
Modern version of Osculum Infame: LINK

120

What are "Generational Spirits"?

Are they passed from generation to generation?

Can parasites be passed from generation to generation?

What is another name for Generational Spirits?

What are witches’ cats called?

Can demons possess non-human mammals?

Can parasites infect non-human mammals?

Can those parasites allow the Hive Mind to communicate to humans through the host animal?
What are "familiars"?

Wy

N
N
N

What is Stranger Things?

Did the Parasite begin by infecting animals [familiars]?

Did the Parasite use the infected animals to infect humans?
When the Parasite infected Billy, did the Parasite gain control over him?

Did the parasite use Billy to spread more parasites to others?

Truth disguised as fiction?

121

Did the cravings of the infected hosts begin to change?
Did the human hosts begin to crave the taste of feces?

Elements of
history disguised
as fiction?

Why is Homosexuality so protected?
If humans are infected with parasites, could the parasites influence the hosts to crave feces?
Is feces-consumption one of the most commons way to transmit parasites?

Over several weeks, the parasites migrate through host tissue and develop
into adult worms inside the blood vessels of the body. Once mature, the
worms mate and females produce eggs. Some of these eggs travel to the
bladder or intestine and are passed into the urine or stool.

CDC - Schistosomiasis - Disease
ша www.cdc.gov/parasites/schistosomiasis/disease.html

Little
Crawlers

dude's finger on /b/ after fingering his girlfriends ass.
also posted a photo of them on his tongue

Malte Mueller

I’ve Contracted My Third
Gastrointestinal Parasite
From Rimming—And |
Can’t Be The Only Gay
Man Suffering

Do jews have a scat fetish? LINK

122

[Homosexuality >>> Feces transmission >>> Parasite infection] The head of the UK's Environment Agency says
that people need їо be ‘less squeamish’ about

drinking "toilet-to-tap" water from treatment
plants, as countries and states around the world
move towards recycling sewage.

Why would the government be so slow to put an end to this:

AUSTRALIA
Home | U.K. | U.S. | News | World News | Sport | TV&Showbiz | Femail |7777 Science

Latest Headlines | Zika Virus | Depression | Cancer

US meat supply is riddled with feces,

doctors claim in a lawsuit against the
government in a bid to wipe fecal
matter from our food

* The government maintains a ‘zero tolerance’ policy on feces in food

* The Physicians Committee for Responsible Medicine says that only applies to
‘visible’ fecal matter

“ They filed a lawsuit against the USDA on Tuesday calling for tighter regulations

==) Bill Gates @
- @BillGates

| drank water made from human feces.

According to a Sunday op-ed in The Times, Sir
James Bevan writes that "drinking recycled
sewage is the future."

RESTAURANTS

Fecal bacteria found in drinks at UK
branches of McDonald's, Burger King
and KFC

M EDT | UPDATED THU, JUL 20 2017-8:21 AM EDT

PUBLISHED THU, JU
David Reid Se f 9 in mà
&DAVYREID73

UP NEXT | Shark Tank 7:00 PM ET Listen

Б found in ice at McDonald's, КЕС and Burger King in the U.K.,

levels were found et Burger King and KFC.
TRENDING NOW

a make it

fa" LIFE
BREAKING NEW. ; let + Ls
Wendy's pe To “Pooping” чыз Whati rh e drinking
in Chili For Over 2 Years [44 MSNBC | water? If you live in one of
——— N these states, it might soon
be recycled sewage
Published Fri, Aug 19 2022 12:12 PM EDT

Annika Kim Constantino
Home | U.K. | News | The Queen | Sports | U.S. Showbiz | Australia | Femail 7 s @ANNIKAKIMC

Latest Headlines | Monkeypox | Covid-19 | CDC | WHO

Big Muck! Investigation finds FAECES
on every McDonald's touchscreen unit

Share f Y

tested as fast food chain comes under
scrutiny for 'not using strong enough
disinfectant'

+ Touchscreens are used before eating food, often without washing hands
“ The samples also found traces of bacteria that can cause blood poisoning

+ Expert at London Metropolitan University said findings are worrying

By VANESSA CHALMERS HEALTH REPORTER FOR MAILONLINE
PUBLISHED: 09:21 EDT, 28 November 2018 | UPDATED: 11:21 EDT, 29 November 2018

123

Is your roommate gay? =
= NEWSLETTER MkzniCcALNEWSTODAY

. Fecal matter found on more
than 60% of toothbrushes in
shared bathrooms

Sharing a bathroom with other people can have its downfalls
— wet towels all over the floor, toilet seats left up, and that
person who never replaces the toilet paper. But a new study
finds there is one communal bathroom issue that is much
more pressing: fecal contamination on toothbrushes.

explains study author Lauren

Aber, a graduate student of Quinnipiac University in Hamden, CT.

r/Coprophiles
ujpa 57d

© NSFW

Breath after swallowing shit ? What is Coprophagia?

15 Coprophagia caused Бу a parasite?
What is Giardia?
What is Isospora?

I've a question guys; after swallowing a lot of poop,
does your breath smell like poop? Вс I've tried to smell
myself and | never smell like poo, but If it does; how
much does it take to disappear, after brushing your
tongue and teeth?

Qs Ом

d) BEST COMMENTS v

e dd «58d

| always brush my teeth when I've eaten ,| love having а
solid piece in my mouth for a while then swallowing it
hole with some water ,| also the after taste when | burp
much later reminding me of my kinky fetish

ӘҢ SReply <p 2

ё 1550 + 1550 • MP · 155d

Оої man that's awesome, | found a tutorial of a sexy
дігі that gives u instructions in what to do to begin to
eat and wow jt man actually worked so damn good ,

Award

11; Share

Put the following videos on your list of things not to watch.
They were included only to prove these demon parasites can
really change people into something that is no longer human.

days ago | couldnt even eat a little piece and LINK1
yesterday | ate a BIG turd with no water ! Or anything ae
it was amazing | ate а lot of shit and І came while I LINK2
did it was amazing LINK3

fa © QU

124

Can parasites spread through piss?

So this orgy was a piss orgy thrown by some friends. Even though it wasn't
officially affiliated with it, it was advertised as a “Pre Wet n Hot” orgy, Wet
n Hot being a big piss kink event that happens іп Palm Springs. It was what
brought me to PS the first time | had visited

BabethePigBoi Sx 18t

It’s starting to sink in now. | screw my courage to my goddamn sticking,
place (literally) and reach down and feel around my hole. And there it is,
little bumps on the inside of my fucking ass cheeks. І had the pox

July 18

events in my life kept me from attending since 2015. So when 2020 came, I was

I've been attending Wet & Hot since 1999, skipping a year here and there but

eager and ready to resume......but that part’s history. So when this year rolled
around, I was determined to get back to the inner pig I know I ат.

This weekend was ‘on fire’ The hottest sex I think I've ever had, not only based on
previous years, but THE hottest sex ever. Laying in a sling. Guys pissing on me while
I'm getting a dick up my hole, ecstatic pleasure feeling my hole getting flooded with
piss and sperm. Feeding my piss to hungry pigs. Then the rush of watching groups of
men feeding each other piss. Just letting all the restrictions and frustrations of the
last 2 years take a back seat to the hottest, raw, breeding I've ever experienced.
Once things got going, everyone seemed hard wired for shameless, anal and oral
sex. The atmosphere was electric and I allowed myself to have the kinkiest raw man
to men sex where the only thing that mattered was the greedy piss-hungry mouths
and holes, craving to be fucked and filled, wallowing in pure ecstasy. I'll definitely be
back next year. And to our first timers, a new world of piggy sex has just opened its
doors for you. Each year I've come back I was able to shed some more inhibitions
until I became a pure bareback cumslut and piss lover. I'm betting you first timers

just found a new avenue of pleasure. See you all next year.

g sheldon (lance on facebook) july

BOIS!!
what an amazing time!!
From the moment of arrival till the end of the event, what a glorious event. Thank
you to all the organizers, volunteers, and event space for all you do to make this
event crazy wild and memorable.
The hottest moments for me this year was at barracks for the beer bust on Sunday.
Wandering around in my diaper for 4 hours while many guys pissed into it, back and
front, soaking it well beyond its capacity. Then to the hottie who graciously accepted
the soggy diaper in his face while we made out, and the crowd watched, that was
really stunningly fun!!! (if you read this, please message me Ө )
Making out with Ben and Jack at different times in the pool was stunning as well,
Thank you Bois. The sensuality and peace was really needed and so much fun, Loved
all the touches and kisses. Thank you
Next year I want to try and stay at CCBC and do some volunteer shifts, I think for
year #4 for me me would be a good time for me to start giving back to this
wonderful community.
Thanks for all the piss, Sexy Peeps!! For all the guys reading these reviews, jerking off
to these reviews and not really believing this is all true, IT IS! It is true, x 10. Get

your fantasies and sexy bodies down to Palm Springs for Wetnhot #26

Pissy hugs

Derek july 19, 2022 at 8:21 pm

I started attending Wet and Hot in 2009 and its been one of the highlights of
the year for me. I just love the feeling of brotherhood of being with literally
hundreds of men who appreciate the glory of piss. After having to miss out of WNH
for two years because of the pandemic and with the ever present worries about new
Covid variants, plus now monkeypox - I wasn’t sure what to expect, but WOW what а
great weekend. I literally drank quart after quart of piss and pissed up so many guy's
asses, I lost count. I also really appreciated having “rimseat row” where guys who
are heavily into eating ass could hang out. I always tell people that the piss scene
seems to attract by far the friendliest, attitude-free group of guys. I've been to FF
events and its no where near as welcoming an atmosphere as Wet and Hot. I'm

already counting down the days until next year!

Stewart Kramer July 1

Always a great event! The organizers do a great job, and there are so many
hot guys with good attitudes. I only wish I could have stayed hydrated a little more

in all that heat, so I could give back a few more piss loads.

g Danny july 2

I wasn't sure what to expect so I figured Га go with the flow...get it? And I
did get it! I snagged one of the rooms at CCBC a opened up due to a cancellation. It
really is like winning the lottery. I rarely ventured outside of CCBC the whole
weekend, working my way around the compound one drenching at a time. I found
so many guys willing to gulp down my piss that I was constantly in refill mode so I
could provide. I fucked and sucked and rimmed and got all of these pleasures in
return. It took me a little while to go from yellow shorts to jock strap to nothing, but
the heat and the friendliest guys made it happen. I made some new friends and
connections that have been hard to make in the past few years. I found my tribe and

we pissed together. Looking forward to doing it again next year!

$ Steven ји

First time at WetnHot and I had the time of my life. I was оп the fence about

0 pm

going for a while, but I finally decided to buy the weekend pass about a week before
the actual event. I had no idea what I was going to be getting myself into, but the
tone was set for me at the barracks on Friday during the registration party! First time
getting pissed on while I had my clothes on in a bar and it was soo hot! That scene

got me super horny and I was in the play area all night long that night!

I met so amazing pigs that I am very much looking forward to meet next year. And
got drenched in piss at the barracks during beer bust while I was in nothing but vans

and a jockstrap.

I will definitely be returning next year to collect more piss and meet more making

piggies! Until next time!

g Tod Carrig July 19, 2022 at 1:01 am

My first wetNhot was in 2019. Returning for more piss-tastic encounters with
sexy men from all over & making new friends definitely surpassed the slice of

heaven that was my first party. Can't wait for next year!

What is blood libel?

Gf) FORDHAM UNIVERSITY

Jewish History Sourcebook:
Bernard Lazare:
Antisemitism: Its History and Causes, 1894

Throughout the Middle Ages the Jew was considered by the common people as the
magician par excellence, As a matter of fact, a number of Jews did devote themselves to magic. We find many
formulas of exorcism in the Talmud, and the demonology both of the Talmud and the Kabbala is very
complicated. Now it is well known the blood pla
Chaldean magic, it was of the utmost consequence; in Persia it was considered as a means o a
delivered all those who submitted themselves to the practices of Taurobolus and Kriobolus. The Middle Ages
were haunted by the idea of blood as they were haunted by the idea of gold; for the alchemist, for the
enchanter blood was the medium through which the astral light could work. The elemental spirits, according to
the magicians, utilized outpoured blood in fashioning a body for themselves, and it is in this sense that
Paracelsus speaks when he says that "the blood lost by them brought into being phantoms and larvae." To
blood, and especially to the blood of a virgin, unheard of powers were assigned. Blood was the curer, the
redeemer, the preserver; it was useful in the search for the Philosopher's Stone, in the composition of potions,
and in the practice of enchantments. Now it is quite probable, certain, in fact, that Jewish magicians may have
sacrificed children, and thence the genesis of ritual murder. The iso acts of certain magicians were

Stnbuted to them in ther character as Jews. It was maintained that the Jewish religion which approved of the

Megan Fox Admits To
Participating in Blood-Drinking
'Rituals' With Rapper Fiancé

АР 27,2022 | [ENTERTAINMENT]

Why is blood associated with magic?
Why is sex associated with magic?

Algeria and the Rites of Eleusis: 1909-1911 [edit]

In November 1909, Crowley and Neuburg travelled to Algeria, touring the desert from El Arba to Aumale, Bou Saáda, and then Dà'leh Addin, with Crowley reciting the
Quran on a daily раѕіѕ 1911: 186-202 During the trip he invoked the thirty aethyrs of Enochian magic, with Neuburg recording the results, later published in The Equinox as
The Vision and the Voice. Following a mountaintop БЕЙ magic ritual, Crowley also performed an evocation to the demon Choronzon іпуомпо Дваспісе, and
considered the results to be a watershed in his magical career ??!

What are magic potions?

More specifically: what are put into potions to make them magic?
What can be transmitted through blood and semen?

Are parasites used to create the ‘magic’?

What happens in Antarctica, stays in Antarctica.
Or does it?

Ok guys, that my post as you will. | have been refraining from posting this for sometime, even back in the older days of antartica on /x and /pol several years ago.. | figure now is a good time as any. | stopped myself
from posting because | feared gangstalking, or being traced, if there was any truth to what | am about to post. Now | just think fuck it, this post will most likely go unnoticed anyways and gang stalking is just an
irrational fear for myself.

My knowledge of Antarctica comes from my best friend of 50 years now. Though we grew up together, we grew up in very different conditions. He was part of the rich family, who owned one of the largest factories in

my home town. | was the opposite, just a naive kid playing around town when we first met. We were best friends then, and | still consider him my best friend now, despite him traveling around the world, going to
Princeton, and doing whatever he wanted.

The point is, he is a 31st mason and has lived a life way beyond | can imagine. despite all this, he always come to visit, sometimes several times a year, sometimes not for years.. but when he does, we usually get
smashed and trashed, hookers blow, even he brought me dmt and other crazy shit. ok enough back story, time for the goods.

this comes Um him, his story hasnt changed, though he only told me this roughly 5 years ago and told me shit would be happening in less than a decade.. this starts with religion, and at first | rolled my eyes, but
as he talked more it sent shivers up and down my spine.. so the masons have been in charge of controlling and releasing information to the public at reasonable levels (that is what he told me the majority of his
masonic duty entails). and the first piece of media they altered was the bible.. a major part of the bible was cut out from the Revelations, revealing where the anti-christ and the beast would emerge from. he said the
section they cut out was the most important.. cont limit reached

22102292333

wow scary trips.. kek is listening..

ok, so the revelations stated that the last anti-christ would be the total opposite of Jesus, spreading disease from an old age which turned most humans into zombies, or some weird shit he said.. anyways, he said
this anti-christ was trapped in a frozen wasteland with magnificent buildings and was being held captive by KMs of ice.. he doesnt know exactly if this is an individual, even the masons think it is a virus of somesort.
the bible didnt specifically state.. but he said, this is where the saying comes from ‘when hell freezes оуег. hell is already frozen over.. once hell is defrozen, then real hell will be unleashed..

he told me these temples in Antarctica have been explored by a group of people in control in the government, the same group of is doing crowd control methods all around the world, have been digging hoping to find
this anti christ burried in Antarctica because some believe it is the key to immortality.. for another small section of the bible did refer to the everlasting life (garden of eden) being hidden right beside this anti-christ..
and in order to bring about the last days, it had to happen anyways.. so teams have been digging, blowing up shit, covering up, stopping visits (though he said you can visit the outside portions of Antarctica, only
those who know will ever get to see those temples), and constantly destroying any information leaked from this expedition...

he told me, several years ago some russian thought he found a portion of the immortality and injected himself with an ancient virus they discovered in a vial in one of the temples.. he even cringed when talking to this
story and said the guy instantly turned blue and froze over. everyone ran out and when they returned his body was gone (now they only work in those giant radioactive suits).. he said they had to replace him with a
body double to avoid drawing notice or someshit in his real life.. cont. limit again

22102293121

he went into great detail about how big and complicated those temples, and he calls it a big giant city, expand across the entire continent. he said from one temple where you enter there are hundreds of rooms,
hallways, traps, all types of symbols and shit on the walls, large books of ancient text no one can read, vials upon vials of random liquids which they cant even remotely identify but he said most contain living
organisms in these vials, and they protected behind large traps shit from indiana jones.. he said theyve already lost over 500 people exploring and now they are using robots, but shit is so complicated you have to
move blocks to open doors, solve riddles.. i dont know, he said its truly a giant mouse trap.. there are keys and legends on the walls, and a single room can contain up to 100 different keys for solving to open a
trap... its crazy shit and they have the smartest people working on it, and they send in 3rd world people to go open the doors when they think they solved it.. its shit i still dont know what to make of.

so some other stuff he told me.. most movies and books are representing what they think will happen when it is discovered.. like transformers (with the frozen bot forget his name), all these zombie movies, and all
this other shit in the media..

im not sure if you guys care, essentially i have crazy stories from him for all these years... a lot of examples i forget because of our drunken binges, but this is the jist of it.. dont know if it confirms anything for you
guys, but its my 2 cents.

nonymous (10: (@NG75HXD) [+1 12/10/16(Sat)09:42:06 No.102294702 - >>102294965 >>102295026 >>102295174 >>102295482 >>102295567 »»102295662 >>102295862 >>102295945 >>102296936 >>102297023

>>102294030
just for you anon.. i will type out everything i know

he said game of thrones (one of the only shows i watch so i can relate to what he said), shows what they think will happen when they discover this antichrist.. they aren't sure it is, but the white walkers are meant to
get normies ready to fight against the possible zombie out break.. and why they think it is soon, a quote һе kept repeating from the bible was, ‘after the war of wars, and after the winter of winters’ is when everything
would happen.. he think the war of wars was from WW2 up until now, non stop fighting across the earth.. and the winter of winter refers to the ice of antartica decreasing and opening up parts of island still frozen..

another crazy fact he said they know, is there will be Jesus’ or Christ, right beside the anti christ.. and you will get to choose when it first discovered.. he think it will be two vials beside each other and you will have
to drink one.. after the russian they put in a ban from ingesting any shit from these temples to prevent anything from happening.. its truly a cluster fuck of arguements because everyone wants to be the first to keep
discovering, but they are in disagreement of what to do with all these random vials they keep finding.. he said each other has random living organisms inside of it and its bacteria and viruses we have never seen
before.. shit which makes apple rot in minutes and monkey explode diarrhea and shaking to death.. but the coolest thing he said was there is a frozen giant skeleton in golden armor in one of the temples holding
the skull of giant reptile (which looks to be over 30 feet tall (the giant), and the reptile head is roughly the size of a уап.. its incredible to see and unbelievable.

127

Mind-control Parasite Sex Magic:
Do you remember back in 2016 when the President of Korea admitted to being mind controlled by a Cult of

Shaman Wizards who were trying to turn everyone into trannies?

> Anonymous <*> 10/27/16 (Thu) 07:34:06 ID: ас20се No.11085987 >>11025001 >>11088005 >>11088008 >>11085013 »»110260!8
File (ise): 8се298083902226... 1р9 (16.58 KB. 316x283, 316:263. madotsyki panic

Troubling revelations about
Seoul's Shadow President’:

The Korea Herald columnist

tw this aintanime plot
1S THIS THE REAL LIFE? IS THIS JUST FANTASY?
GOOGLE ‘CHOI SUN SIL’, | AIN'T EVEN JOKING
HAHA I'VE HAD ENOUGH

‘It’s actually a system where Choi Sun-sil
tells the President what to do’

http://english.hani.co.k'arti/english, edition/e national/767405.html

http://www.straitstimes.com/asia/east-asia/troubling-revelations-about-seouls-shadow-president-the-kcres-hersld-columnist

South Korean President Park Geun Hye releases a statement of apology to the public during a news

conference at the Presidential Blue House in Seoul, PHOTO- REUTERS

NTERNATIONA

Swirling Scandal Involving Shamanistic
Cult Threatens S. Korean President

F

Former Mir Foundation official says power broker Choi received detailed а п мен
presidential report almost daily, апа led meetings on governance
And the ties are interesting, indeed. Choi Soon-sil is the daughter of a man the
Behind-the-scenes power broker Choi Sun-sil received and reviewed 30 cm-thick “Presidential repot || president considered her mentor, Choi Tae-min. He claimed to be a pastor from a tiny
packets” from the Blue House on a nearly daily basis until as recently as this spring, a witness recently a е " S З
а ы pseudo-Christian sect, but а leaked diplomatic cable from the U.S. Embassy describes
him as a 'Rasputin'-like character and his "church" is described by Korean media as

more of a "Shamanistic cult." The New York Times explains further:

"Mr. Choi was the founder of an obscure sect called the Church of Eternal Life.
http: Awww. npr org/sections/thetwo-wsy/20 16/10/28/49986491 5/swirling-scandsl-involving-shamanistic-cult-threstens-sxorean-president

! Anonymous (ID: 62% %87) == 10/28/16(Fri)02:38:52 No.94885324 P> >>94885473
>> 757

What is known about this 8 Goddesses group? Any ideas as to their beliefs or goals?

Anonymous 10/28/16 (Fri) 08:41:57 ID: 4b942f No.8001039 >>2001071 >>2001115 >>8001293

»»8001006
Anonymous (ID: CETIS) == 10/28/16(Fri)02:40:44 No.94885473

- £12 choi sun sil
- #0102 ABE hyundai group(not hyundai car) File: june-bday-wide.png (282 KB, 488x318)
2294885324

-CJD 01012 CJ group
-235 SHS xp 201 SAIS wife of deputy minister of Culture, Sports and Tourism
- Зр 21S 8 2] S*?! wife of hanhwa group owner 13 their main goal is to turn men into women
27169 +201 wife of industrial bank owner
01212 wife of famous lawyer
CIL SERI ЫРА 279 governor of korean red cross

128

Honey bees communicate through chemical/pheromone emis- —
: - . ence, one of the significations of the presence
sion as well as with dance symbolism. So, what if all the weird (оғ the beehive among the symbols of Masonry

clothing choicesand hand signals which public figureheads ex- may be construed as a symbol of leadership
vo . of its Master, and the storing up of wisdom,
hibit during broadcasts are actually the parasites themselves knowledge and light, represented by the honey

trying to give or request specific instructions? of initiation,

The bee represents “the hive mind” meaning they are all
groomed to protect the hive. They do what it takes to
protect the hive.

They tell us in many ways.

The elite love Sodomy above all else. Why, anyway?
Not a Scrooge McDuck gold coin bath, or blowing up a
priceless artifact because they can? To paraphrase Sam
Hyde (Can’t find the original quote) “You’re an evil FBI
agent and the worst you can muster is to rape some
kid? OOOOOH! So scary! How about try to blow up the
moon, or make a bunch of animals go extinct if you
love evil so much?” Could it be the reward center of
their brains are so messed up by the worm, that butt
stuff is a higher pleasure than anything to them?

Scottish Rite

Compared to the three degrees in standard freemasonry, the Scottish Rite, an
offshoot of Freemasonry, has 33 degrees . Thirty of these degrees are “appendant

degrees”, in that they are not higher in ranking but lateral. This means that a member
with a 21st degree in the Scottish Rite has the same ranking as someone with the 3rd
degree of masonry.

pubmed.ncbi.nlm.nih.gov/676277€

The temperature profile of the pathogenic yeast
Candida albicans

M Lemos-Carolino, A Madeira-Lopes, N Van Uden

PMID: 6762776 DOI: 10.1002/јобт.3630221004

Abstract

A strain of Candida albicans was found to have an associative temperature profile with respect to
growth, thermal death and yield on glucose. The ARRHENIUS plot of sustained exponential growth
displayed two branches in the supraoptimal temperature range with ti
growth around 552 C, the final maximum temp:
the initial r 1m temperature for growth around 42

optimum temperature for

endent in the supraoptimal range and

optimum and the initial maximum temperature for growth.

What is Spirit Cooking?
Does it involve the consumption of blood, raw flesh, and feces?
What organisms are found in blood, raw flesh, and feces?

NOTHING TO SEE HERE, JUST A BUNCH OF
ULTRA RICH PEOPLE HAVING DINNER AT
A TABLE OF A MOCK HUMAN SACRAFICE

130

Q The New York Times ©

Fed up with online harassment from
conspiracy theorists, the performance
artist Marina Abramovic breaks her
silence about the treatment she's faced. "I
need to open my heart. | really want to ask
these people, 'Can you stop with this?"

e

Marina Abramovic Just Wants Conspiracy Theorists to Let
Her Be

Keith369.. жеңеді for truth ©kKeith359 і
тубат

The ебат isn't the treatment she faced, it's the

treatment her and her followers subject other

people to.

Lia

3 more replies

1 сасна wobbystarbuck > 6l
IP " ytim
*
Nah iu em sick person, your 'art" is free to

be and should be criticized.

не reply

(o The —— (Save pinned post) ©The
n -

anytimes

"Artist"

The StrayWolf (Save pinned post) (211
€ » Dont be afraid to show her art then

f. еңсені of Truth @RepOtTr id
6, E f g to @nytim
Here is Marina Abramovic performing one of her

"Spirit Cooking” events, with blood used to write

"666" (bottom left) and an upside-down star. This
doesn't help to stop the theories

Conclusion: the “workers” are predominately those who call themselves ‘jews’, but they also include many
other people who have likewise become possessed by parasites which now manipulate or control their body.
These “workers” are likely unaware they are being controlled and assume their wants and desires are their
own. They can usually be identified by their behaviors, particularly their fierce devotion to the jews and the
collective’. If a “worker” was infected during their developmental years, then he will often display identify-
ing facial malformations (such as the jewish nose, knobby knees, narrow eyes, an aptitude for baldness, etc).

It can take many years for a host to progress from human, to NPC, to possessed, and for this reason, the par-
asites prefer to infect children. Many poisons and toxins have been put into our environment in order to
speed up this transition.

However, any individual who becomes too powerful or influential is brought into the fold through various
more extreme methods, most often relying on the consumption of parasitic larva by means of magic potions
and spirit-cooking events.

In the past, these parasites were called demons, devils, spirits, and sin, and the same techniques which were
historically used to exercise a demon from a human host can also be used to remove a parasite from a hu-
man host. Although these exorcisms can cure the infected, often there remains lingering and irreparable
damage to the host's brain and body.

Just as with the demon at Gerasene, these “workers” are merely victims, themselves, and are being con-
trolled against their will by the parasites which has infected their body. These workers are not the true ene-
my, but they must be treated as such due to the immediate danger they pose to the uninfected.

What is the Matrix? LINK

131

7. THE DRONES

Who are the drones?
How much debt exists in the world?

how much debt in the world

IMAGES SHOPPING

9,010,000,000 Results Anytime ”

Ф 8 4& 45 (4%)

BANK OF CHINA (HONG KONG)

©

CONFIRMATION LETTER

AS DULY AUTHORIZED OFFICERS OF BANK OF CHINA (HONG KONG) LIMITED. WE
HEREBY CONFIRMED WITH BANKING RESPONSIBILITY THAT THE ACCOUNT HERE

National Debt by Country

NOVEMBER 1, 200
UNITED STATES

OESCRIBED IS AUTHENTICATED, FREE AND CLEAN OF ORIGIN FROM THE ACCOUNT О
ANY TAXES IMPOSED THE DUTIES OF ANY NATURE, AS IMPOSED BY ANY GOVERN:
AUTHORITIES.

PREVIOUSLY BANK ACCOUNT NO.
BANK ACCOUNT NO. 34 ;$11-AM 1.
WAREHOUSE RECEIPT NO. C-3 10 UP TO 31 10
U.S.D. ACCOUNT NO. 61-1 '85/081-11 '85

AMOUNT U.S. $ 2, 180, 000, 000, 000,
000.00 U.S.D.

18021 23388

$152 trillion

Global debt is at record highs, amounting to $152 trillion or 225 percent of global GDP
(Chart 1). Close to $100 trillion or about two thirds are liabilities of nonfinancial firms
and households-— private debt. The remainder is public debt.

,

(TWO QUADRILLION, ONE
HUNDRED EIGHTY TRILLION U.S.
DOLLAR)

UPDATED UP TO BALANCE SHEET
WITH INTEREST AS OF NOVEMBER 1, 2007

TOTAL OR U.S. $ 2, 590, 058, 000, 000,
000.00 U.S.D.

Who owns this debt?
Root of all evil?

DEPOSITOR FR. JOSE ANTONIO DIAZ
ALIAS SEVERINO STA. ROMANA
SOLE OWNER / SIGNATORY TIBURCIO VILLAMOR MARCOS
RESTRUCTURED JANUARY 2, 1986

MATURITY AUGUST 11, 2009

WE FURTHER CONFIRM THAT THE SUBJECT ACCOUNT COVERED BY SWIFT CODE NO
BKCH CN BJ 66593777 AND POST CODE-MCD 1008818 TLX 22254 BCHO CN.

Гето бууу Tun i

CHAIRMAN VICE-CHA}

BANK OF CHINA BANK OF CHINA

Did you think Elon was the richest of them all?

ivar Orn Heimisson

Since | was a kid and realise that parasites exist, |
have wanted them all destroyed. Complete parasite
eradication of the planet should be a top priority.
The fact that this is not the case makes me theorize
that the elites are actual parasites in more than just Eating
behavior.

Have you heard of any of these names?

132

How does one become a drone?
What is the basilisk?

Pliny the Elder describes the [Basilisk]:

1. Snake-like creature

2. Not more than 12 inches long

3. Power to kill

4. Power is associated with the eye

"To look directly at a basilisk meant certain death"

[Medusa]:

A creature associated with snakes [worms].
Small, 12 inch long worms protruding from skull.
Has the power to kill through the eye.

[Baylisascaris]:

Shaped like a snake.

Small, 12 inch long.

Has the power to kill through the eye.

@ cdc.gov/parasites/baylisascaris/index.html

CDC Centers for Disease Control and Prevention

CDC 24/7: Saving Lives, Protecting People™

Parasites - Baylisascaris infection

infection is caused by a roundworm found in raccoons. This roundworm can infect people as well as a variety
of other animals, including dogs. Human infections are rare, but can be severe if the parasites invade the eye (ocular larva
migrans), organs (visceral larva migrans) or the brain (neural larva migrans).

Image: Left: Embryonated B. procyonis egg, showing the developing larva inside. Right: Larva of B. procyonis hatching from
an egg. Center: Raccoons are hosts for the roundworms that can cause Baylisascaris infection. Credit: DPDx, U.S. Fish &

Wildlife Service [4

If a parasite needs to influence a host's cognitive abilities, where would it most likely be found in the body?
What major organ of the central nervous system directly connects to the optic nerve?
Does the drone parasite enter a host through the mucus membrane of the eye?

133

“и David Szymanski @

One of the most frightening things I've
ever heard is when someone pointed
out that the existence of the uncanny
valley implies that at some point there

was an evolutionary reason to be
afraid of something that looked
human but wasn't.

Picture of someone about to be droned by a Vril Type 1 Lizard.

The Vril type 1 lizards (terrestrial aliens) are parasitic, carnivorous and
malevolent. They dwell underground. They’re dumb but smarter when they turn
a human into a host (drone). They have a proboscis (called the Quill) located on
top of their head. The proboscis (which looks-like a chocolate chip) contains
everything that the lizard is (it's consciousness). Their lizard body is dead once
the proboscis leaves its body. They can only do this once in their lifetime and if
they fail (turning a human into a host), they die. The victim that is about to be
bodysnatched parasitically is unconscious or restrained. The proboscis enters
the victim's eye and spirals around the optic nerve. It then proceeds to go to an
area of the brain (driven by taste) that tastes like butterscotch to them. Then,
they do a feeling of holding your breath and pushing outwards. Finally, it does
what's called Sweating the Quill (at the tip of the proboscis), which excretes the
parasitic cells that take over the human body. This kills the person and replaces
their consciousness with the Vril's lizard's consciousness. The Vril lizard
becomes that human (after some recovery time).

This transition from Vril lizard to human is what's called Droning. Also, this
transition is what is referred to as demonic possession and shape-shifting. Once
a Vril lizard becomes a human, they are then known as a Drone, Host of VriLor a

Parasited Host.

(Eye of Horus)

ZZ

Worm

L

ж

| am the WORM you сап never delete. September 11th, 2015

134

Can parasites utilize mrna technology?
Can mrna technology transfer memories? ale
: : 3 i
What is the Resurrection Chamber of Gilgamesh? ie
. : : California sea hare study demonstrates
Are parasites used to create immortality? memory transfer via RNA

Memory transferred between

Date: May 14, 2018
Source: Society for Neuroscience

Summary: | Memories can be transferred between
organisms by extracting ribonucleic acid
(RNA) from a trained animal and inject-
ing it into an untrained animal, as
demonstrated in a study of sea snails.

Share: f м Ф іп %

FULL STORY

Memories can be transferred between or-
ganisms by extracting ribonucleic acid (RNA)
from a trained animal and injecting it into an
untrained animal, as demonstrated in a
study of sea snails published in eNeuro. The
research provides new clues in the search
for the physical basis of memory.

[.] Anonymous 12/14/21(Тие)02:39:34 Мо.30505806 )» >>30505817 >>30505913 >>30533367
File: black-eye-club12.jpg (228 KB, 500х814)

>>30505789

Almost every (real) Elite you see has been alive for thousands of years, because they're an Archon hopping from shell to shell.
Now here's the other crazy part, pic related. Their shell might start out with a human soul. For example Bill Gates really was
Bill Gates when he was in his 20s, but then "they" came for him and inserted a worm into his eye which burrowed into his brain
and took over. They do this to anyone who gets too important. This means Archons physically exist, in the form of a brain
parasite.

Also, Stargate SG-1 was a military funded soft disclosure of the true nature of our reality, that sentient brain worms with
thousands of years of knowledge are jumping into human shells and ruling us, and that the Egyptian Pharaohs really were these creatures,
back then ruling us openly as gods.

(
(Mm,

Cer e cen a ан

Ancient Egyptian Temple
in the city of Aswan

135

They have tried to convince you that reptilians look like this.

ANS
MINN

Nis

[basilisk]-sized worm coiled around the host's
pituitary gland

If the host dies, does that destroy the parasite? LINK

If a parasite can move from host to host, how long could the parasite live?
Longer than the host?

How long do humans live?

What is MK Ultra?

What insect is used to represent MK Ultra?

How do Monarchs know the destination of their migration?
How many generations does it take Monarchs to reach their destination?
Do butterflies start as worms?

What is a [Monarch]?

СТЕ - rr

Portrait of Queen Elizabeth I

Not a snake.
Is it something more like this: LINK

The painting today tist's
originally looked

A mysterious image of a coiled snake has appeared in a 16th
century painting of Queen Elizabeth I, the National Portrait
Gallery has said.

The Tudor queen was depicted with the snake clasped in her fingers in
an original version of the work, but it was replaced with a bunch of
roses.

The paint has deteriorated over the years to reveal the serpent's
outline.

137

The smiles of
the drones:

Who is Huma Abedin? LINK

If you can see their molars when they
smile, but that smile still doesn’t reach their
eyes...

.. they are sus.

138

Comment DOSSERVATOR

139

8. THE QUEEN
What is the Hive Mind?

How does a queen bee control her hive?
How does a queen ant control her nest?
Always [female]?

How do radios operate?
Is а single radio station able to control the sound produced by millions of individual radios?
15 the purpose of the parasite to 'set the host to the right radio frequency’?

What is Dollhouse? [Stop Loss 2.9]
What is a neural radio?
What is the Mind Whisper?

Truth disguised as Fiction?

140

Who is the Hive [Mind]?

What is a neural network?

Can an entire planet have a neural network?
Earth’s [Mind].

Is the Hive Mind a sentient being? LINK

Is the Hive Mind a Fungus?

c
Anonymous 1D: 2x23L25h Sat 12 Oct 2019 19:24 -

Quoted By: 22229670896

Mushrooms communicate
with each other using up to
50 ‘words’, scientist claims

>toxoplasmosis

>enteric yeast

The oldest civilizations did 2 things to control people.
Feed them grain, and make them worship cats.

Is this a coincidence?

Professor theorises electrical impulses sent
by mycological organisms could be similar
to human language

Linda Geddes Science correspondent

» Wed 6 Apr 2022 00.01 BST

What is Cosmic Death Fungus? LINK1 LINK2

Anonymous ID:JDC2tq0i Sat 12 Oct 2019 18:56:30 No.229658108 = Report
Quoted By: 722229663656

Interesting how every culture has a monoculture grain (grains are a favorite of fungi)

| Fats, Oils & Sweets
USE SPARINGLY

Milk, Yogurt & Cheese
Group
2-3 Servings

Meat, Poultry, Fish,
Dry Beans, Eggs

& Nuts Group

2-3 Servings

Fungus

Fruits Group
2-4 Servings

Bread, Cereal
Rice & Pasta
6-11Servings

Anonymous ID:ox/63Uo3 Sat 12 Oct 2019 19:40:00 No.229661850 == Report
22229661522

One of the symptoms of candida infection is "brain fog" which is just the fungus hijacking your neural network. The dumber the parasite makes you,
the more sentient the parasite within you becomes.

141

X8,000 2рт

Father figure...

ti Toxic Masc @ Retweeted

Poz Breeder
@PozBreeder

Pet worm...
My fave pig | knocked up and who | still
breed just found out he knocked up his
first bottom bitch. My strain lives on.
#poz #gifted #bbbh

9:03 РМ · 26 Mar 14

7 Retweets 32 Likes

Q ца; Q ка

% Larry Hewes & @Poz4Chasers · 2d

Replying to @PozBreeder

Congratulations on your new "grandson"! So
glad to hear that his "father" is still toxic. Are
you still toxic? And are any of you 3 guys
interested in being Gifters? There are a hundred
chasers for every Gifter globally. | am glad to
refer all Gifters to chasers in their area.

Tweet your reply

142

Who is the real enemy? (Eye of Horus)
Always [female]?
Who is the Queen of Heaven? (J44.19)

[Mystery, Babylon the Great, the Mother of Prostitutes and Abominations of the Earth]

"You shall not make for yourself an idol, or any likeness of whatis in heaven
above or on the earth beneath or in the water under the earth. Exodus 20:4

MUI
i^

пт

yl Ш

hed
a MIN Tii OE. di

dams s. di = Білді eee
elene — ivioon Gi

зе! Oddess
Greco-Roman marble statue A.D.

E E

Attis was a Phrygian god of the Sun
and born of a virgin. He bled to death

after castrating himself in order to

e

transition into a female moon goddess.

143

| am Inanna, Queen of Heaven
On my way to the East

Her cult was deeply embedded in Mesopotamia and among the Canaanites to the west. F. F. Bruce describes a ТЗ ШЕТШЕ А ЗЕЕ ТЕТ [STR ORE CIE Cu ETSI 207922 by the

Akkadians. He links Ishtar, Tammuz, Innini, Ma (Cappadocia), Mami, Dingir-Mah, Cybele, Agdistis, Pessinuntica and the Idaean Mother to the cult of a great mother goddess. "8!

Does the moon influence parasites?

Rod of Asclepius Caduceus

144

What is the Ouroboros? Hexagram of Satan

/
оға tle

С Ji rI

А

44 eT enn; БЕЙ?»

One ring to rule them all.
pwrwiwverinne i е One ring to find them.
A Наар Опе ring to bring them all.

lease And in the darkness bind
them.

/

%
ш/ту/ Му

қ J) Ale
е

Г tamm.

Astarte [edit]

The goddess, the Queen of Heaven, whose worship Jeremiah so vehemently opposed, may have been possibly Astarte. Astarte is the name of a goddess as known from Northwestern Semiti
regions, cognate in name, origin and functions with the goddess Ishtar in Mesopotamian texts. Another transliteration is "Ashtart; other names for the goddess include Hebrew mnwy (transliterated

Ashtoreth), Ugaritic ttrt (also ‘Attart or ‘Athtart), Akkadian DAs-tar-tü (also Astartu) and Etruscan Uni-Astre (Pyrgi Tablets)
According to scholar Mark S. Smith, Astarte may be the Iron Age (after 1200 BC) incarnation of the Bronze Age (to 1200 BC) Asherah 119]

с Mark 5 i
Astarte was connected with fertility, sexuality, and war. Her symbols were the lion, the horse, the sphinx, the dove, and 7171919 indicating the

sc
planet Venus. Pictorial representations often show her naked. Astarte was accepted by the Greeks under the name of Aphrodite

145

What was the Medusa?

Was Medusa female?

Was Medusa a Queen?

Snakes for hair or snake-heads?

Who is the Parasite Queen of Heaven?

146

Conclusion: The Dragon, that old serpent, which is the Devil and Satan, is a transsexual Hive Mind sentient
neural network of fungi which encompasses the entire world and which collectively calls himself the Queen
of Heaven and Moon Goddess of Sex. He uses parasite demons to infect the children of God, by which he
tempts them, influences them, kills them, and even takes complete and total control over them through de-
monic parasitic possession in order to turn them into obedient sex zombie slaves which he uses to remake
this world into one in which the Queen rules over all. (R20.1)

—
p" |— ы
— ШЕГІ!
DNE RESISTANCE BUILD,
e WHICH 15 IDEAL
2 FOR SPEED RUNS.
THIS IS S0 SCK.
KS
ace”
ee mere 25,
4 > =.
cy А
Wee? EE
Was :
| [ І

147

9. TRUTH AS FICTION

Rik Lesel

Well, much of that is actually this little talked about
method of the elite. It follows the requirements of
i iversal law which requires

ROTM is quite obvious once you know of it..
Enjoy...

в a a
a —
THE ELITE'S DO TELL US THROUGH
THEIR BOOKS AND PUBLICATIONS,
MOVIES AND NEWS RELEASES WHAT
THEY ARE DOING - THIS IS CALLED
REVELATION OF THE METHOD. IF
YOU ARE TOO STUPID TO RECOGNIZE
IT FOR WHAT IT IS THAT IS YOUR
PROBLEM FROM THEIR POINT OF
VIEW. IT IS A FORM OF RITUAL
MOCKING OF THE VICTIM.

1 1

When truth is presented as fiction you are
lulled into a "it's just SciFi" mindset. It's
not their fault, they told you--you are just
programmed to beLIEve it's all SciFi.
The Parasites behind the curtain and
their "Jaffa" even tell you who to blame.
The WEF, The Rothschilds, the "elite".
Those things are "fronts". Do you
honestly beLIEve the real baddies sign
their own names? THEY LIVE is a

documentary.

OMiCRON.

CEU eire, АДЫ

Pee £d C С

1963 movie OMICRON
An alien takes over the body
of an Earthman in order to
learn about the planet so his
race can take it over.

What is Adrenochrome?

« Fringe

52.Е9 < All episodes >

Snakehead

Episode aired Dec 3, 2009 - 42m

Drama Mystery Sci-Fi

Walter examines some bodies that have been infected with unusual worms.
Olivia and Peter run an investigation after speaking with a survivor. Meanwhile
Walter demands more independence from Peter.

148

How do you identify them? [emotions]

tottion
42

FIRST The year’s most original story of ШІ EY

Къл

Мам,
the fiar in

The entire,
uncut novel ÆJ

Imagine small worms taking over a
host’s central nervous system!
Good thing it is just science-fiction!

Why were the Goa’uld kicked out of 109 star systems

\

by the Asgard?

ТЕГ

What is a Mind Flayer?

What is the Infection Carrier? [2005] LINK
What is Borrelia burgdoferi?

How does Lyme disease become chronic? LINK
[Infection Carrier]

View Same Google iqdb SauceNAO Trace & tapeworm-parasite-similar-to-nep (...).jpg, 123КІВ, 960x551
Anonymous ID: 2t54bdEN Sat 12 Oct 2019 21:08:06 No.229669575 = Report

bump.

Super fascinating subject. | saw this Asian horror movie where the parasites infected from banging the huge tittie asian chicks
and most guys couldnt resist! eww parasites nasty and wicked!

149

Imagine if people could actually

become addicted to fast food?

What would you do for something you need so
badly that if you cannot get it, you die?

He who controls the spice controls
the universe.

Prank Herbert

AZ QUOTES

Why assassinate doctors?
Why assassinate biologists?

WE ARE OF PEACE.
ALWAYS.

THEY ARRIVE

Interesting neck... LINK1 LINK2

TUESDAYS 8/7c
9%,
абс start here

WATCH A BNEAK PEEK AT ABC.COM/V

"We mean you no harm. We
seek only peaceful co-
existence."

What did HULU mean by this? LINK

PUBLIC SERVICE ANNOUNCEMENT

BROUGHT TO YOU BY JAMES DASHNER

Help stop the spread of the Flare. Know the symptoms
before you infect your neighbors and loved ones.

The Flare is the virus Flarevirus
(V3FLR), а highly contagious
manmade infectious disease
Flarevirus was originally created as a
biological weapon, protected under
government sanction, and held in
secure facilities in the Southern
area of the former United States
of America, The virus was released
during the Sun Flare Catastrophe
because of massive damage to its
Quarantined location

The Flarevirus causes a
progressive, degenerative illness of
the brain, resulting in uncontrolled
movements, emotional distur-
bances, and mental deterioration
The result has been the Flare
pandemic.

“Алу Suspicious Subyects

AR WARNIN

Changes in personality (irritability,
unprovoked anger, indifference, depression)

Scientists are in
Clinical. trials, but there is no
standard treatment for the Flare
at this time. The virus is generally
lethal, and has been documented
as ап airborne contagion.

At this time citizens must
unite to prevent further spread of
this pandemic. By learning how to
recognize yourself and others as
Viral Contagion Threats (VCTs) you
will take the first step in the battle
against the Flare.“

The incubation period averages
5 to 7 days, although the onset
of symptoms and the severity of
those symptoms vary greatly. Aides
have been dispensed to ай major
cities to help identify VCTs. You

ate stage

Should be reported immediately to the authorities

INCE

can recognize these individuals
by their red shirts and medical
badges. Seek them out if you
Suspect yourself or someone else
of infection

Al! government entities have
adopted a zero-tolerance policy
for dealing with VCTs, Any attempt
to hide or conceal symptoms or
those exhibiting symptoms will
be met with severe punishment.
Any discovery of usage of mind-
numbing pharmaceuticals to mask
symptoms will result in swift and
immediate consequences. Any
VCTs to report themselves will be
treated humanely.

WARNINI
Muscle spasms
* Disorganized and/or aggressive speech

* Decreased cognitive abilities (difficulty
in making decisions, learning new tasks, loss
of short term-memory)
Problems with balance

* Involuntary facial movements

* Auditory hallucinations
* Severe paranoia
* Dementia
Sudden aggression
Self-mutilation

History

After the Sun Ра this wiki меу and came to

conclude that only

ofy 9"

population would have enough resources for

Search all wikis
e remaini

e Coalition searched for a means of population control
The Flare

living. Fearing war and civil unrest, |:
hat would eliminate large numbers of people quickly and as humanely as possible
was discovered by Katie McVoy, a scientist of the Post-Flares Coalition after she researched

the biological weapons that AMRIID had in containment. McVoy believed that the disease

151

Do the infected realize they are infected?
Do the infected believe their actions are their own?

Alien Intruder: A game of deception, aliens, and paranoia.

Instructions: Alien Intruder is a game played by 6 to 15 people. One player acts as Game Master and one
player assumes the role of Hive Mind. The remaining players are Scientists on a Research Mission. (Total
Players / 6) of the Scientists are secretly Alien intruders.

Hive Mind: The Hive Mind is the puppet master pulling the strings of deception. The Hive Mind knows who
the Aliens are and who the Scientists are. This player observes the game and tries to manipulate the Alien
Intruders to eliminate all the Scientists. The Hive Mind wins if 3/4 of the Scientists have been eliminated
before completing all of their Tasks.

Alien Intruder: This player does not know they are an Alien intruder. For all intents and purposes the Alien
Intruder(s) thinks they are normal Scientists.

Scientists: The Scientist's job is to survive and eliminate the Alien Intruder(s) or complete all tasks. The
Scientists do not know who the Alien is. The Scientists win if the Alien(s) are dead or if they have completed
all of their Tasks.

ile (hide): -::.png (760.86 KB, 455x658, 65:94, Dostoevskij.png) (h) (u)

On the sidelines, re-reading the novel "Crime and Punishment" by Dostoevsky, | came across this passage in the last pages - very curious because, even
if imagined 155 years ago, it seems to adapt quite well to today's everyday

Was that what you were aiming for?

Fyodor Dostoevsky Crime and Punishment, 1866 - (Pevear & Volokhonsky Translation)

He had dreamed that the whole world was doomed to fall victim to some terrible, as yet unknown and unseen pestilence spreading to Europe from the
depths of Asia.

Everyone was to perish, except for certain, very few, chosen ones. Some new trichinae had appeared, microscopic creatures that lodged themselves in
men's bodies. But these creatures were spirits, endowed with reason and will. Those who received them into themselves immediately became possessed
and mad.

But never, never had people considered themselves so intelligent and unshakeable in the truth as did these infected ones. Never had they thought their
judgments, their scientific conclusions, their moral convictions and beliefs more unshakeable. Entire settlements, entire cities and nations would be
infected and go mad.

Everyone became anxious, and no one understood anyone else; each thought the truth was contained in himself alone, and suffered looking at others, beat his breast, wept, and wrung
his hands. They did not know whom or how to judge, could not agree on what to regard as evil, what as good. They did not know whom to accuse, whom to vindicate.

& ° Achan

e | C Greater Socio-Political Wormoid Theory General Anonymous (ID: tnokoARf)
09/30/21 (Thu)15:51:15 No.341575738

You were issued a warning! ; ; File: 1633031475132 jpg-(164 KB, 1400x700, OCFEFF23-9110-4660-8132-2(...).jpg)

You were issued a warning for posting >>>/p0l/341575738. ; EX |5 Disney/Pixar's "Inside Out" soft disclosure for the

: ; : қ hidden Wormoid empire?
Off-topic; all images, debate, and discussion should be

current events. Off-topic threads should be posted оп /|

Your warning was issued on September 30th, 2021. The пате you were posurig wiui
was Anonymous. In addition to heeding this warning, please review the rules and FAQ.

Now that you have seen this message, you should be able to post again. Click here to
return.

YOU ARE BANNED

[ Home | News | Biog | FAQ | Rules | заррот аспат | Advertise | Press EHE |

About * Feedback * Legal * Contact

152

KA NAMA KAA LASER AMA

г DO NOT MAKE: ^
SPERCEWITH, WORMS):

free

H

2% N
SE T Wut
153

hittps://files.cathox.moe/9rbtxh.patf
hitns://pastebin.com/SqkPBxuy
hitps://ghostbin.com/980Kl

є &. - Every Animal is a carrier

*
= >

штен тты

Parasites eat hormones Vitamin C deficiency
90% infections undiagnosed

^

FDA FOOD PYRAMID { y
EQUALS WORMFOOD o A

Always been

^s

‘ay

Anonymous (ID

>>342231938
Ayear ago | ve e we are, on the cusp of y he evil and degeneracy that has been growing
exponentially t ( / all operate the same. ТІ

VV]
VV

hat if every theory we have about kikes doesn't tell the full story, and all of this is actually about
parasites? What are the odds that our slavemasters are actually being controlled by advanced
parasites that influence their behavior? It would sort of explain how kikes, trannies and shills
seem to instinctively follow the same narrative and use the same tactics of subversion, almost to
the point where it's supernatural. And it would explain how kikes have managed to keep their
subversion shit going for centuries despite having no real leader or authority figure. Even your
every day poorfag loser tranny shitposter uses gaslighting and subversion in ways that a normal
person never would and would never think to. And they probably aren't getting orders from the
elite kikes to post that way. It just seems unnatural, when | really think about it. | Know this is
some real schizo spitballing, but the shills' absolute horror and fear concerning Ivermectin had me
thinking about it. You can really tell the shills are scared out of their minds. | know that
vermectin being a proven and effective treatment will eat into their profits, but their screeching
seems out of proportion this time. It has me wondering if there are parasites out there so
advanced that they almost have some kind of sentience that can push agendas through multiple
generations. No other explanation has ever really explained how normal everyday people learn
how to act like subversive kikes. Even my sister acts like a shill. | know a lot of it can be
explained away by social conditioning but sometimes it just feels far fetched, especially
considering how kikes have kept this game going for generations. The kikes who set this shit in
motion aren't even alive anymore, yet they're going by the same playbook without missing a beat.
can see why a lot of people seem to think they're literal demons, but I'm not very religious. At
this point, if you have knowledge in the general occult, stuff like NWO, the real "reptilians"
ЖТТ Т. РУЖ ancient history, you will start to see trends. Essentially, ‘parasites’ is the last piece that actually
File (36 KB, 398x378) makes sense of the whole charade from beginning to end

n]

b > could be saved if we force feed the entire population
mer/para onetlipills
—9— simple all along and that s the BIG SECRET? So the whole plan was to use the medical
sounds to ironic to be true , and yet i've heard more outlandish shit than this

industry to allow for prolonged parasitic
infestations by only treating the symptoms,
encourage sugar and an acidic diet to make
sure the parasites enjoy their stay inside
Anonymous ID:ER153vMb Sat 12 Oct 2019 21:00:31 No.229668923 us and also promote gay sex and open
relationships so that they can spread to new
a parasite just flew over my house hosts.

Pretty funny

that turned out to be true

E Anonymous (10: ФИКРРОН)) ЕН 09/1
File (73 KB, 8

THERFUCKER THIS WAS AN ANIME/WEEB THREA cal tendencies , | STARTED WATCHING THIS WEEB SHIT WITH VAMPIRES (and was enjoying it ) till yo faggy

STUDIED GLOBOH O HISTORY enough to look at this shit and instead of being like oh sweat a schizo post
no fucking у

fuck уо otherfucker you've opened а can of worms to big to ignore now

155

https://archive.4plebs.org/pol/thread/228145641
https://archive.4plebs.org/pol/thread/229657 155
https://archive.4plebs.org/pol/thread/336908730
https://archive.4plebs.org/pol/thread/338 156838
https://archive.4plebs.org/pol/thread/339152068

https://archive.4plebs.org/pol/thread/339641 184
https://archive.4plebs.org/pol/thread/3401 19307

https://archive.4plebs.org/pol/thread/340144974
https://archive.4plebs.org/pol/thread/340273967

https://archive.4plebs.org/pol/thread/340553112
https://archive.4plebs.org/pol/thread/340579847

https://archive.4plebs.org/pol/thread/340700972
https://archive.4plebs.org/pol/thread/340746087
https://archive.4plebs.org/pol/thread/340854654
https://archive.4plebs.org/pol/thread/340873041
https://archive.4plebs.org/pol/thread/340893512
https://archive.4plebs.org/pol/thread/340909892
https://archive.4plebs.org/pol/thread/340922339
https://archive.4plebs.org/pol/thread/340954193
https://archive.4plebs.org/pol/thread/34 1108506
https://archive.4plebs.org/pol/thread/341147625
https://archive.4plebs.org/pol/thread/34 1163823
https://archive.4plebs.org/pol/thread/341 177320
https://archive.4plebs.org/pol/thread/341 178156
https://archive.4plebs.org/pol/thread/34 1203079
https://archive.4plebs.org/pol/thread/34 1212408
https://archive.4plebs.org/pol/thread/341213370
https://archive.4plebs.org/pol/thread/34 1252068
https://archive.4plebs.org/pol/thread/34 1282105
https://archive.4plebs.org/pol/thread/34 1300962
https://archive.4plebs.org/pol/thread/34 1300993
https://archive.4plebs.org/pol/thread/341324147
https://archive.4plebs.org/pol/thread/34 1345186
https://archive.4plebs.org/pol/thread/34 1390519
https://archive.4plebs.org/pol/thread/34 1413067
https://archive.4plebs.org/pol/thread/34 1510958
https://archive.4plebs.org/pol/thread/34 1603938
https://archive.4plebs.org/pol/thread/341731608
https://archive.4plebs.org/pol/thread/342128558
https://archive.4plebs.org/pol/thread/342452507
https://archive.4plebs.org/pol/thread/342772366
https://archive.4plebs.org/pol/thread/342846288
https://archive.4plebs.org/pol/thread/344695548
https://archive.4plebs.org/pol/thread/345546445
https://archive.4plebs.org/pol/thread/345929629
https://archive.4plebs.org/pol/thread/346081078
https://archive.4plebs.org/pol/thread/3466 19609
https://archive.4plebs.org/pol/thread/346886501
https://archive.4plebs.org/pol/thread/347 083132
https://archive.4plebs.org/pol/thread/348065059
https://archive.4plebs.org/pol/thread/34981 1727
https://archive.4plebs.org/pol/thread/349917493
https://archive.4plebs.org/pol/thread/350480518
https://archive.4plebs.org/pol/thread/350795552
https://archive.4plebs.org/pol/thread/351 199742
https://archive.4plebs.org/pol/thread/351444387
https://archive.4plebs.org/pol/thread/353357 195
https://archive.4plebs.org/pol/thread/353396341
https://archive.4plebs.org/pol/thread/46140732

https://archive.4plebs.org/pol/thread/46 146968

"So basically the world is controlled by
parasitic mind bending sentient worms. They
spread through degenerate behaviour, which
explains homosexuality, pedophillia,
beastiality etc. There is historical evidence
dating back thousands of years and the people
in charge don't want you to know. The cure is
really simple, just take some de-worming
medication and wait a week."

156

ITS
OKAY
TO DE-
WORM

D Anonymous (ID: 7253) [el 10/03/21(Sun)21:52:52 Мо.342014033 P >>342014217 >>342014288 >>342014316 >>342014320

(making my blog post here instead of a new thread)
HOLY FUCKING SHIT YOU FUCKING FUCKS WHY WHY WHY FUCKING SHIT PISS FUCK FUCK NIGGER SHIT
PISS

WHY DID I DO IT WHY THE FUCK DID I DO IT

»be me
>got horse meds

>also got meds to give me liquid shit direrihha

>take both

>start shitting really hard

>like a fucking volcano outta my ass

>nothing in the first 3 eruptions

>wait about 10 min

>oh fuck feels like i got a log coming?

>go to shit

>spew it out HARD

>feel something long

>sweet relief.

>

>,

>feel something rubbing on my ass

>stand up

>a fucking tape worm

>a FUCKING TAPE WORM

>IT ALIVE

>THIS THING IS AT LEAST 2 FEET LONG

>ITS WIGGLING AROUND IN THE TOILET BOWL

>IT WAS TRYING TO GET BACK UP MY ASS

>SLAM SHUT THE BOWL

>FLUSH TOILET LIKE 10 TIMES

>CHECK

>ITS STILL IN THE TOILET BOWL

>HO-LEE-FUCK

>PUSH IT WITH THE TOILET PLUNGER AT THE FLUSH HOLE
>FLUSH WHILE WRANGLING THE TURD WORM

>WORM IS FINALLY FLUSHED

>FLUSH ABOUT 20 MORE TIMES

>ALSO FLUSH BLEACH AND OTHER CHEMICALS DOWN MY TOILET TO MAKE SURE ITS NOT LURKING THERE FOR MY ASSHOLE
>FLUSH ALL THE CHEMICHALS SO IT DIES

>PROBABLY ACCIDENTALLY MADE MUSTARD GAS IN THE PROCESS

WHAT IN THE ABSOLUTE FUCK

TREASURE COLLECTION

ІШІ

(ШЕ

LJ Parasites Anonymous (ID: СИЕЗІ) 25 08/17/22(Wed)08:14:36 No.391455506 8) » >>391456196 >>391456591 >>391456662

Are these tiny fellas really influencing humans that much?
Are their effects making an appearance within our politics or society?

Have you been down this path before and attempted to rid yourself of these? If so, any results?

D Anonymous (ID: ӨУ/ПЕЗІЗ)) = 08/17/22(Wed)08:15:30 No.391455592 >

| need the itchy ass remedy

Anonymous (10: (KERGBBEID) == 08/17/22(Wed)08:22:39 No.391456196 >
>>391455506 (OP)

Cool it with the antisemitism.

Anonymous (ID: ЖШ) ҒА 08/17/22(Wed)08:27:00 No.391456591 > >>391456896
b: 1630143173143 jpg (94 KB, 1080x690)

22391455506 (OP)

as really ir

Bono, even the flu virus has зеза наета side effects to enhance its spread. Parasites are capable of much more advanced behavioral
modification, the "n is if those changes are E
e their effects j ап appearance w
I the rumors of rampant degeneracy are true, they’ ve an entire biosphere of them, not just an ecosystem
е you beer n this path befo nd attemp to rid yourself of these? If so, any re
PUN works 8 тові. І take it quie аа | ja like eating sushi and tartare 1 make no excuses for this and know it's risky to consume food like this.

| don't crave sugar at all anymore (easy food for parasites). Thoughts are much less intrusive. | actually feel thirsty for water more often (low hydration extends time for eggs to
hatch in gut). General well being is better as a result.

Given enough time, /pol/ will probably figure out how to get rid of parasites that are in extremely difficult to summon forth to kill, i.e. vertebrae, marrow, nervous system,
muscular tissues. Gl parasites are oe easy targets.
n your general wellbeir

j it take for t ng any differences 7
A tio rons for just deser а being, six for what it is now. Two series did it va me.

| did not always follow directions though. I'd frequently take around 3x-4x the recommended dose with no ill effects beyond a fever in the first week. Something just got
instakilled in that instance, because parasites that die excrete their entire gut microbial load. They literally shit themselves when they die, because it promotes reinfection by
any lingering eggs by inducing hatch conditions. That's why they recommend a 1 month series. Kill the adults, and kill the young when they're most vulnerable every time they

hatch.

Twoj@ јео ipo /
ocrysrzczaniu

E Anonymous (ID: 44%/ғедһа)) ЕЗ 10/31/21(Sun)18:33:56 No.345559815 >
File: Attach53663 20211028 090033.jpg (553 KB, 1564x1564)
rm ^C "
22345546445 (ОР)
22345559252
22345559275
Also, don't know if you guys have skin problems but a friend of mine has been struggling with
scalp psoriasis for years.
Here's a pic she sent me while going on the cleanse (wormwood/cloves/black walnut hull
те» haay Wut tincture)

And a pretty strict diet of pineapple, raw pumpkin seeds, fresh garlic in hot sauce

159

File: 9098E283-695B-4482-892B-9(...).jpg (533 KB, 828x1364)

©) Ipol/ was right about deworming Anonymous (ID: EIZA) = 11/03/21(Wed)22:59:29 No.345999246 >
>>345999754 >>346000128 >>346000442 >>346000544 >>346000559 >>346000620 >>346000643 >>346001258 >>346001560 >>346001665

>>346004429 >>346004696 >>346005069 >>346005083 >>346005146 >>346005153 >>346005280 >>346006228 >>346006550 >>346006732
>>346006868 >>346006920 >>346007043 >>346007402 >>346007927

| was а skeptic of the deworming threads, but thought Га give the Маск walnut, wormwood, anis, and oregano
oil regimen a try given that I've had heavy brain fog and fatigue for years.

>Week 1: nothing happens

>Week 2: shitting 3-4 times а day full-size logs, stomach feels like it's boiling throughout the day (that mean’s it's
working Imao)

>Week 3 night 2: farting uncontrollably and pissing off the wife, she yells and me to go to the can to get rid of
them. | shit straight fire and feel something thin passing through the end of it.

>look into toilet bowl instinctively from last 2-3 weeks of checking stool
>see 4-inch long roundworm floating there dead

>realize it's likely been in there for years, stealing my male vigor like a nigger in the night

>start hyperventilating about how much of life I've missed

>| now trust strangers on pol more than my own primary care doctor for medical advice

Anonymous (10: QM) ШЕ 10/28/21(Thu)18:57:03 No.345202590 |» >>345202744
: asad.png (78 KB, 178x331)

been using the dog dewormer(pic related) for a week and my sugar cravings * porn addiction have completely vanished. | used to fap
to trannies.

>>33026847
>dandruff is fungal
Dandruff is lymphatic stagnation. Your body invites the fungus to help break down toxins that are sludging up your sewer system. Look up Dr. Morse ND on youtube.

The reason we need thousands of threads on this shit is because topical treatments don't work. You can't just kill the parasites/fungus/whatever or starve it. You have to take
a dual approach.

#1 you have to stop eating tons of garbage (meat, grains, starches) that clog up your digestive system. If you don't do this they'll always have plenty of food.
#2 you should stop eating in general. Juice or water fast in this time period. Remove all the fiber. Your body directly absorbs the nutrients and it starves any parasites.
#3 take antiparasitics alongside. Nothing solid. Just tinctures.
1 lost 20 Ibs worth of hookworms, ropeworms, one or two tapeworms, and endless amounts of candida. l'm talking you're going for months and its STILL coming out. Did that with a juice fast.
People who freak out or think they've made progress seeing a little bit of yellow shit in their stool haven't seen shit. You have to starve the fuckers, rehydrate the fuckers with juice/water, then
dase d ee herbs. NOTHING else works. It must be done all together. And | am convinced that once you do it the PROPER way you will literally be superhuman compared to 99.99%

You will have to go through literal Hell to get there and | mean it. Absolute Hell on Earth. You'll feel like you're dying, like you should quit and give up. That's exactly what the parasites are banking
on. They are demons. The worst stuff is black and smells like rotten eggs. Immediate relief when you get rid of that too. I've seen anons refer to it as the "black goo" and it's 100% real.

160

p021- 12-4 11 -21-3 32- cropped.jpg ( 46 KB, ‹

fi і Anonymous (10: GRMBOWVEAD) == 12/04/21(Sat)11:14:36 No.3507 Б» >>350733573 >>350734841
22350736103 >>350736387 >>350739332 >>350739349 >>350739753 >>350740003 >>350740487 >>350740833 >>350742128 >>350742601 >>350742611 >>350742800
>>350743085 >>350743216

utoimmunity 1 me g ant рг the recent nd nearly killed me tin h pericarditis and
dial tamponade. At oint ek in a hc under inte jaws bloc ЕСЕ / around

what he did fi

) / ent me home the next c / )
back to oct hosp X for prednisone. you've ev hig f pred for а peido of time
r the de t turns you into. In old folks hon y call її 1 vil's tic-tacs'. The only t y got close tc ming violent with p

ich | passed and found in my stool tod 5 te га could continue to live and

Anonymous (ID: GRMBOVEFA)) = 104/2 6:50 No.3 770 » >>350733223 >>350736387 >>350740833
le: 2021-12-4 11-19-17-cropped jpg (

When | came into г
any of them. Howe

1:3

went completely unmentic

and CREDIB rmer (cheap sub
and it's time to fig ck. After all, ho

Anonymous (ID: CAM (Tue)12:06:51 No.342232244 » >>342232411 >>342232558 >>342235821 >>342237348
1633409542134 jpg (7 )

trol of me very strange ł pened to me. i ho
wierd left I a ] a fu cked up bladder
is out. feel like t C сопеа аго the optic

I've been after the parasites for months now. | pas a few here and there. The TURPENTINE and everything else you could do. I've had DE in the fridge for a while. Well | made a small safe protocol for
myself of the ingredients on hand and I've had a aches in the upper turn of my colon for 6 ths. Yesterday and today without warning | let go of the colony.. Lots like in your pictures and 100s
more of unidentified parasites including flukes and species of insects like pink grubs.

This evening | had a huge surge of energy along with rushes of anger. It's the die off and I'm so happy. Ә $.
Show less

оу 109 ” &» REPLY

didiydi 4 yes
Amazing Tom, congratulations! What is DE?

өз P REPLY

Tom Tutt 4

didiydi Diatamatios Earth is diatoms from the bottom of a dried seabed. comes in a powder I ordered 2 bags 5lbs each. for $20 with shipping. under a microscope the powders look like small
beads with razor edges that will cut up anything it passes..Totally safe, | even use it around windows and doors for a non toxic bug killer. It works internally and externally.

dh 9 REPLY

iydi 4 yea
Tom Tutt ah yes, | know about it, thank you. What was your daily/weekly routine than (times&quantities) if you care to write? | have a feeling your way will work for me. I've used turpentine in
the past, so that bit | know. Just wondering what else to combine it with. Also, | did too many enemas in the past and it causes lazy colon so can't have too many of those and can't afford
colonics at the moment. How often did you do enemas?
Thanks Tom!

dó2 P REPLY

Tom Tutt

didiydi | kept it simple the only thing that took time was getting the correct Turpitine. | ordered Diamond G from Georgia.

3 days a week 4 sugar cubes with 1 Tsp turpitine dropped on the cubes. and eat them,. | TSP organic castor ой ог 1 frozen castor . | took DE 1 Tsp in a glass of water mixed it as well as
possible. | only drank distilled water. while doing this 3 week protocol. | got results daily but not what | expected.

After Three weeks | just waited and drank distilled water.

Three weeks past and | started all over. and within a hour I got a pain and the results were proven. even the nesting sites past,. | was really surprised. That week | only ate a light diet and I
sugar cube a week.

3 oreginol drops a week to kill any eggs left behind.

161

Anonymous (ID: 75АВоМлі ) E E 10/02/21(Sat)23:09:52 No.341855713 І» >>341856085 >>341857182 >>341857894
ile: 1633009844321 jpg (302 KB, 1000x1607)

ЕЕ 22341792228 (ОР)

I solved my 30-year long depression іп 12 hours with a single dose of horse paste. The biggest redpill
T

is that it's always been about the worms.

Anonymous (ID: sKrymą5s ) 5% 10/02/21(Sat)17:40:21 No.341819907 P> >>341820172 >>341831807

ile: 1632972792149.jpg (460 KB, 1536x2048)

I just started 3 days ago with all this shit

garlic-tumerin-ginger-tabasco-chilli seeds mixtures to drink

black walnut wormwood and clovers

І never had such diarrheas | feel like im shitting out everything | have inside me like every 3 hours

but | must say

| never felt better

at first some headaches and stuff
but literally the second day | started | wake up and | just feel so much better, lighter, brain fog gone and all that shit
now | will do those memes and then do a 20 days fast while drinking apple cider and pumpkin seeds

/pol/ was a shithole but this wormpill opened my eyes and makes me see the world differently
B

Anonymous (ID: -kMSESL4i ) ЕШ 10/02/21(Sat)21:14:46 No.341842958 |» 22341843848 >>341843893 5341844038 >>341844405
File: Wyrmpll.jpg (281 KB, 887x1701)

>no symptoms

>took the wyrmpill

>nothingburger

>mfw 12 days later

Anonymous 10: 3rsajc3f Sat 02 Oct 2021 21:27:57 No.341844405 ЕШ Report

>>341842958
Same here, the only symptom | had was farting a lot, but | never linked it even to the wyrmpill.

| did a 3 day ivermectin/mebendazole treatment (2x10mg ivermectin, 2x100mg mebendazole per day), while drinking a few cups of tansy tea here and there. Just to
give it a try. | ended up shitting out dead worms.

I'm now convinced it is definitely a good idea to do this twice a year. | felt better afterwards too, my craving for booze is gone and | don't fart as much either.

>>341843136
Li
Probably. A mild laxative is recommended just in case, as a sure-fire method. But if you're not constipated you're probably good to go with a cup of coffee.

Anonymous 1D:qyZzP7s59 Sun 03 Oct 2021 19:21:41 No.341958794 Bl Report

Quoted By: >>341959155 >>341959633 >>341960811 >>341967520 >>341971379 >>341971497
2201850167
same, і took garlic clove chewing + wormwood, black wallnut cloves and few more capsules, shit out small red
worms after few days, the difference is 1000% if not more in how good i feel, sugar craving gone, porn craving
gone, gay thoughts gone, can hyperfocus for 5000+ words reading in one go, sleep 100x better just as you said
even though im a NEET and never leave house just by statistics of how many hands your food and packages go
through paired with % of people (80-99%) infected with t gondii or other parasites its a guarantee everyone is
infected due to interacting with other { humans }

View Same Google iqdb SauceNAO Trace $ wtfworms.png, 2MiB, 1538x2048

Anonymous ID: 6h9dtaoz Sun 03 Oct 2021 19:20:51 No.341958704 ЗЕ Report
Quoted By: >>341963407 >>341970319 >>341970753 >>341971455 >>341973131 >>341975279

Porn does nothing for me now and candy is gross. | used to be addicted to sugar and now | don't
give a shit. | used to take allergy medicine every day, sneeze 20x a day. Now | don't sneeze. |
had to wear sunglasses all the time, the sun hurt my eyes. Now | don't need them. What the
fuck! D

Anonymous Ір: дулр7550 Sun 03 Oct 2021 19:33:54 No.341960231 Bl Report
Quoted By: >>341960703 >>341971715

22341959155

yeah i know, i doubted i had any type of parasites since i never go out at all, but then i shit them out after few days,
then i started to think and look into statistics how many % of human pop has just ONE OUT OF 1000+ parasites
that can infect humans, and its ~40-80% for t gondii depending where you live, its impossible to not be infected
Since some nigger at the store never washes his hands while stocking up the product line * a lot of npcs put things
back from their cart to shelves so all those hands touching the box can infect you. now add in all other possibilities
like door knobs etc... even if you dont touch it or go near them other people do that touched those packages, its
literally exponentional superspreading world disease that can only be defeated if you continuously deworm
yourself

prophecy of Kt png PISKAN BRIS? Anti parasites cures everything Anonymous 10: 6h9dtaozZ Sun 03 Oct
2021 19:15:46 No.341958167 ШШ View Reply Original Report

Quoted By: >>341958581 >>341958605 >>341958794 >>341959407 >>341960211
>>341960339 >>341960477 >>341960896 >>341961377 >>341961459 >>341961487
>>341962599 >>341963594 >>341963973 >>341964425 >>341965585 >>341965657
>>341966548 >>341966560 >>341967167 >>341967417 >>341967507 >>341967639
>>341968407 >>341970011 >>341971646 >>341971943 >>341972033 >>341972445
>>341973449 >>341973479 >>341973484 >>341973851 >>341973987 >>341974059
>>341974105 >>341974223 >>341975279 >>341975677 >>341975989 >>341976221
>>341976250 >>341977104 >>341977574 >>341977706 >>341978155 >>341978282

кз Mon 27 Sep 2021
216 ж

"в also why Jenrses jimmes are so rustied and
Аер purging the theeeds Alas the autism has been
unleashed and there is no getting off tma ride These
евз are fucking crazy ful of autism and scream
of old /poV.

Candida, fatigue, allergies, sugar cravings, porn addiction, insomnia, eye strain, covid...is all gone
because | took anti parasitic medicine. How the fuck is this possible? What does it mean when anti
parasitic medicine cures most people's problems?

FROGS EAT WORMS
FROGS EAT WORMS
FROGS EAT WORMS

[406 / 121 / 160]

View Same Google
4032x3024

iqdb SauceNAO Trace $ 6261D0FA-ED39-4D9C-8DCD-1A890D21 (...).pg, 2MiB,

——
е 65

i "RT s

Anonymous 1D: 8VumbhAE Tue 05 Oct 2021 22:13:53 No.342261061 ЗЕ Report

Quoted By: >>342264512 >>342264665 >>342267766 >>342269320

>>342242913
Lord give me strength. | keep passing these fuckers

C Anonymous (ID: (4УеВу2Ғ4:) = 10/06/21(Wed)11:08:47 No.342330180 >

Two years ago | started regularly deworming and taking vitamins, have since healed from being practically dead.

Anonymous (ID: 6042149) == 10/06/21 (Wed)13:40:12 No.342339818 >

| did a 3 day cleanse, not even with pharma and shit out all kinds of stuff. feel more energized and
less foggy. more motivated even and I'm also noticing desire to reproduce when | didn't before.

My results seem to be very positive, after 6 days of cleansing (Cloves mixed with flax seeds and eating separately
pumpkin seeds)

| feel lighter and | feel my sense have become sharper and more vibrant.

| also feel less urges to watch porn and | actually want to go outside, | also feel that my emotions are less apathetic а!
less cynical.

| also feei less urges o watch pom and acy wart 1o go oxide, | ано ee that my emotion are les apathetic and less cynical.

Anonymous 1D:UclBLafo Wed 06 Oct 2021 01:14:24 No.342282030 ЗЕ Report

1 have to say, | enjoy how | feel after eating the horse paste. 10/10, would recommend

Anonymous 1D:1D4punEF Wed 06 Oct 2021 01:45:56 No.342285728 =5 Report
Quoted By: >>342287174 >>342296510 >>342297874

I've been paraguard for a week 4x daily by 30 drops in a enteric capsule. | have not identified any critters in the stool. However effects
are obvious.

1. Barely hungry. Zero carb cravings.
2. | feel lighter. | run better. Used to run cross country. Coaches commented on my ‘perfect form’ which went away. It's back. Never
thought twice about this just figured out of practice.

The worms tried to psyop me and tell me I've had enough and that wormwood is dangerous. | persisted and during that nights sleep |
woke up in what i'd describe as a psychotic type of state. Basically | was dying. But | logically knew | was not. But a voice in me kept
insisting that it didn't matter what | thought ... it was a fucking terrifying thing. | prayed to Jesus to do battle for me and that stopped
that right then and there. It was VERY alarming. I'd consider this schizoprhrenia type thought patterns. They weren't mine, since | am
a stable genius unlike DJT who is a pretender.

That is with paraguard. | just got IVERMECTIN and | took a 17mg dose which apparently is all you should need to throttle them. I'll
probably come back in a week or two with that.

ГІ Anonymous (ID: &GAZEFUGf») [1 10/06/21(Wed)01:47:16 No.342285878 >

22342279755 (ОР!
| don't care what you suspect. | was misdiagnosed with IBS for 3 years. Parasite meds cured it for 27 dollars. | was paying

350 per month for my ibs meds

C Anonymous (10: GEINS

>>342290082

been looking for a good dewormer. this one looks good, im gonna give it a go. | water fasted for 10 days and
when i finally pooped i had big white worms in my poop it was super gross. My doctor gave me a "trial run" of
a antibacterial that also worked as an antiparasytic and it cleared all my symptoms up completely, i told him
and asked for a proper protocol with the drug so it would kill everything and symptoms wouldnt come back but
he didnt want to prescribe anymore.

10/06/21(Wed)03:19:08 No.342295083 |» >>342298218

C Anonymous (ID: G3 3) шш 10/06/21(Wed)03:33:02 No.342296481 »

>>342283699
No pictures but | just woke up and shat out two.

162

Same Google iqdb SauceNAO Trace FAVBwOcWQAUcgq-fjpg, 292КІВ, 1536x2048 Anonymous (ID: 6 ЕУ Э) = 10/06/21(Wed)03:57:40 No.342299021 » >>342299191
Anonymous 10:782721%А Sun 03 Oct 2021 20:53:51 No.341969790 ЗЕ Report
Quoted By: »»341970116 >>341970372 >>341970547 >>341974298 Just checked my stool an hour ago after taking wormwood and fasting all day. Do it yourself and tell us

Guyana real what you find or shut the fuck up. My mind is blown.

This thing left my asshole and theres still a lot more to go i sometimes feel like theres something moving inside my ass 0 Anonymous (ID: €EED) = 10/06/21(Wed)03:59:30 No.342299191 »
my orders are still coming 0_0 omg the jew worm is real.
>>342299021
| shitted out worms today and my allergies are gone and sugar cravings are too.
iqdb SauceNAO Trace & F8C5D5B8-5DF2-41C1-899B-3E41FF468 (...).jpg, 63KiB, 717x1024
аута mm [Report C Anonymous (ID: (ETD) = 10/06/21 (Wed)05:18:17 No.342306638 >
>>341958167 >>342304857 D
My mothers lyme's disease symptoms were cured the same fucking day she dosed horse paste. (((Тһеу))) are gonna | just did it, after taking wormwood and fasting all day. Its all fucking true. See for yourself. Also no urge
ban that shit, watch. i to masturbate today, incredible.

IRI Piet ev REIS rav vn PND e sor FUCK MOEN нт Anonymous 1D:V4TGFHjm Tue 05 Oct 2021 03:33:57 No.342159110 Report

—— 22342158952
е! something rubbing on my ass n. Ivermectin horse paste worked for me. | no longer crave degenerate porn anymore. Not memeing.

land up
Anonymous (ID: Ф009) = 10/05/21(Tue)13:32:42 No.3422d

fucking tape worm =a
IFUCKING TAPE WORM ai Anonymous 1D:3rsAjc3f Sat 02 Oct 2021 23:29:53 No.341857894 ЕШ Rep

Ета IG IS AT LEAST 2 FEET LONG == 22341855713 22342202060
Ара ет A id i ucl BOWL Same here, since | did the wyrmpill treatment my craving for alcohol has been zero. While | dewormed myself and | no longer have allergies.
WAS TRYING ТО GET BACK UP MY ASS. before | drank every day because | felt like shit in a shitty world.

The stuff that came out of my ass was freaky to see, but now | am convinced and wished | had

known earlier.

Anonymous Ір: ЕодзМујі Tue 05 Oct 2021 03:18:09 No.342157375 SS Report

SH IT WITH THE TOILET PLUNGER AT THE FLUSH HOLE ‘serus, тэе OMA DOWNY TOLET то ARE SURE та OT DONG TENE FOR MY азис І used to be gay, and then | took Ivermectin. You wouldn't believe how many worms and parasites came out of my butt... And after

UOH VHRLE WRANGLING THE TURD WORNI ee 5 ee that, | no longer felt the urge to have gay sex with men and transexual women. Now | am only attracted to real women.

JORM IS FINALLY FLUSHED
USH ABOUT 20 MORE TIMES Ivermectin changed my life. 7

SO FLUSH BLEACH AND OTHER CHEMICALS DOWN МҮ TOILET TO MAKE SURE ITS NOT LURKING THERE FOR MY ASSHOLE
USH ALL THE CHEMICHALS SO IT DIES * 9hHnS7Xkh e Е
кел А ооа теза Anonymous 10: 9hiins7kh Mon 04 Oct 2021 23:46:45 [241 / 56 / 135]
No.342132841 Sf View Reply Original Report
IAT IN THE ABSOLUTE FUCK =S Quoted By: >>342133290 >>342133746 >>342134336 >>342134605
- — г "TID 22342135281 » 5342135322 >>342135784 » 5342135833 >>342135963
Anonymous (ID: (KKOriEpb) [ll 10/05/21(Тие)15:39:01 No.342216070 > 22342216473 rel 4 342136192 >>342136449 >>342136755 >>342137205 >>342138277
3 >>342141307 >>342141344 >>342141979 >>342143496 >>342143583
22342212642 >>342145074 >>342145250 >>342145397 >>342149312 >>342152221

>>.
оар anon, | am on day 7 of the pine gum spirits cleanse and my psoriasis has diminished b: Kiop E E igre M eee
y d y [poet Ne ур: y TOOB, zone 7s) >>342154936 >>342155064 >>342155816 >>342156457 >>342157094

over 50%. Nothing | have tried has ever worked like this. | have more energy, mental clarity, less head aches CHMX6RITRZHGDOVZCYLAMJSMBE jpg
pep ‘view Same] [Google] 1595] [SauceNAO] [Trace 22342160160 >>342160664 >>342161350 >>342161631 >>342162067
тт >>342163222 >>342163722 >>342164710
You actually think something that comes from pine tree sap is suddenly bad for you, especially when people Have you taken the dewormer pill yet?
have been using it since the time of Hippocrates? The only reason you take issue with pine gum spirits is >All mammals need dewormer at the vet
because it is called "turpentine" so you think it is some how harsh. The medicinal effect is in the dose, >"N-no, not you got, don't you dare take it!”
" еге >Brain fog gone
| Anonymous (10: штіһдв/7 ) == 10/05/21(Тие)17:53:21 No.342230776 9 >>342230997 >Test way up
4 1jpg (631 KB, 960x782) >See worms come out as result
гаа >Realize you were being poisoned Бу (((them))) this whole time using parasites and now know the cure.

и М >>342230698 When did you take the worm pill (gel) and realized we uncovered the secret to our own liberation?

0 Anonymous (ID: CEED) H2 10/06/21 (Wed)20:28:52 No.342381702 І» >>342382084
File: unnamed1 jpg (822 KB, 3024x4032)

>>342378013
| took pyrantel this morning and shat out some worms already. I've taken some Castor

|| Anonymous (ID: ) = 10/05/21(Tue)18:35:30 No.342235461 » Oil to try and get the rest out. I'm also fasting.
е: B6B7B973-0626-42FB-822E-4(...).jpg (30 KB, 637x358)

22342235071

>| don't like to fuck with my body, it works fine

Dude | don't get sick either, | literally had no side effects aside from bad skin and

some lethargy, guess what? | took the wormwood and have been shitting out 2 = T

threadworms for the last week. It's real, if you think you don't need to at least try it С Anonymous (10: GEED) Н 10/06/21 (Wed 22:00:59, No 342396206) b.

then you're fooling yourself 5 | took a dewormer this morning and shat out worms already.

My ass is itchy right now. It feels like the next group is ready to come out. I'm a bit scared of
[] Anonymous (ID: €IR7is3) zz 10/05/21(Тие)18:33:12 No.342235198 » what | will find this time.

| had crazy anal fixation until | dewormed myself, now the thought of sticking my dick in a pooper is Anonymous (ID: (CINES) zia 10/07/21(Thu)14:00:27 Мо.342472562 І» >>342472850
fucking grossing me out. what in the fuck ???

Also why do you guys buy all kind of crystal lady suplements | went to the pharmacy and just told the
lady | had worms and didn't know which so she gave me some meds that work against many kinds and Day 1 - Begin water fasting

took the top dose. Day 2 - Pyrantel and Castor Oil
Day 3 - Turpentine and Castor Oil

[| Anonymous = 10/05/21(Tue)19:19:38 No.342240467 |» 22342240522 >>342240536 | already saw worms in my stool yesterday from the Pyrantel. | also had a VERY ITCHY BUTTHOLE that has now went away.

342240583 >>342240708 >>342240874 72342240988 72342241063

le: D58B00A8-27FE-40DC-8A4D-1(...).jpg (2.12 MB, 4032x3024)
ь 7 Му wife went from fever and headache with bad sore throat to fine іп 6 hours

>>342228968 (OP)
WHAT DID I FUCKING TELL YOU THIS LITERALLY ГІ Anonymous (10: Nkx9ZuG7 ) = 10/07/21(Thu)18:06:40 No.342495579 >

I'm on day З of my detox

Anonymous (ID: “аумв/Нах ) == 10/07/21(Thu)17:55:24 No.342494331 P> >>342494412 >>342494609 >>342495005

JUST CAME OUT OF MY ASS idk if a strong link. correlation not causation. | did an organic parasite cleanse recently and shit out all kinds of weirdness
that could have been parasites. I'm not a bad eater normally so | can't imagine what others are shitting out. | feel much
healthier and more in the moment. its weird.

inonymous 1D:4nRrPkDa Tue 28 Sep 2021 16:45:02 No.341254452 ШІ Report C Anonymous (ID: Gd») == 10/07/21(Thu)18:45:42 No.342499662 >

Duoted By: >>341254585 >>341254733 >>341256151 >>341256765 >>341260540 >>341261444 >>34127 1224 Why does deworming cure homosexuality?
>>341253329 Why do | по longer get erections from watching дау рогп??
They release toxins into the stomach and brain. Used to be a fag until | detoxxed myself. Getting rid of parasites and worms isn't a meme. | broke up
after detoxing myself after having a relationship for 3 years. Feels disgusting to think back about what I did.

163

L Anonymous (10: (6222 4 ( 9:43:08
File: Screenshot 2021-10-05 1.4(...).png (194 KB, 392x484)

ші 22342219942 (ОР)

Tve been experiencing some mild herxheimer reactions (as the parasites die,
they release toxic crap into your blood; similar stuff happens with other
T chronic diseases). I've been taking diatomaceous earth, tansy tincture, iodine,

as well as some pills | bought on Etsy (picrel) that are a combination of black
walnut hulls, cloves, and wormwood. I've been working on the deworming
process about a week. | have been getting headaches for a couple hours
starting from 30 minutes after each dose. I'm unironically thinking "that means

it's working." Admittedly my diet was shit before and it's not much better now (gotta mix the

worm pills with the sugary stuff they like, right?) but I'm hoping the herxheimer shit ends soon.

1 have seen some small worms in my poopoo, so that has encouraged me to continue.

C Anonymous = 10/05/21(Tue)19:21:31 No.342240679 » >>342240765 »»342240826 22342240864.
File: A371DC54-A66E-4211-B76E-C(...).jpg (1.61 MB, 4032x3024)

| - 22342240522
Better contrast

I'm currently on day 3 of my detox:

Day 1 - Fasting
Day 2 - Pyrantel and Castor Oil
Day 3 - Turpentine and Castor Oil

| already saw worms in my stool yesterday and had a really itchy butthole, which went away after | fully emptied my
bowels. It seems it's working. | took the Turpentine around noon but | don't really feel anything other than a bit of
nausea. | took 2 sugar cubes with about 1/2 teaspoon on each. Just took the Castor Oil an hour ago so that should
kick in soon.

The plan for tomorrow:

Day 4 (morning) - Turpentine and Castor Oil
Day 4 (evening) - Break my fast and have a nice dinner

Then | will recover, eat healthy, and monitor results. | will do a follow-up detox in 2 weeks time.

C Anonymous (ІП: 448ЖІККӨ)) == 10/07/21(Thu)19:59:07 No.342507458 |» >>342507653

| | Anonymous (10: #19169) i Е 10/05/21(Tue)20:23:49 No.342247936 » >>342249251
ile: kike.jpg (1.61 MB, 4032x1960)

1 was symptomless save for farting too much. | did a 3
day mebendazole/ivermectin run and | shat out some
parasites.

| fart a lot less, and have also stopped craving or
drinking alcohol.

| didn't take pics but it resembled pic related. There were small ones too.

| Anonymous (ID: ‘GagnV5tw)) == 10/07/21(Thu)19:52:16 No.342506669 |» >>342507054
b: IMG 20211007 144607857 sc(..).png (2.34 MB, 1875x2500)

22342485227 (OP)
To all the naysayers saying "well noone is showing us pictures of their poop" well, here you
D fuckin go. l've been on the black walnut/cloves/wormwood for a week now and had the
serious urge to shit.. crapped this little fucker out. Try and tell me that's mucus or something
other than a threadworm. | shat out my first ones about two days in and on the third and fourth
day | had a SERIOUS sugar craving and satiated it. Basically gave them some energy for the
new generations just hatching. I'm on a full sugar fast and eating strictly fats, proteins and non
starchy veg. | feel perceptibly different and | feel good being responsible for my health BUT it
is very reminiscent of a nofap streak where the cravings are super intense and almost overrode my own
thinking "NO". This shit is very real and | hope you all take it seriously, I'm a healthy male in my late twenties

Please somebody help me tell me how to reverse this i just want to enjoy my gay porn and i cant
because It doesnt turn me on anymore please how do i reverse this

| thought all this talk about deworming and homosexuality was bogus i just want to get off to gay porn
please somebody help me reverse this i dont know what to do

C Anonymous (ID: 4665202) 213 10/07/21(Thu)19:56:32 No.342507157 № >>342507323

22342506669

| take a spoon of sugar laced with turpentine. The idea is the parasites go for the sugar and end up
consuming the turpentine and die off. | feel better because of doing turpentine

C Anonymous (10: auf) == 10/08/21(Fri)17:48:35 No.342622271 »
File: IMG 20211008 081214 01 _01,jpg (544 КВ, 1132x1515)

4 >if this works why doesn't anyone post pictures of worms in their shit
Here you go, this is from this morning. Day 9 on wormwood/black walnut/clove remedy.
Tell me these aren't fucking worms. It's even more obvious in person.

C Anonymous (ID: MEB) 1: 10/08/21 (Fri)00:38:21 Мо.342538645 |» >>342539075 >>342539151 >>342539218

with indescribable issues with motivation and focus for a loooong time. Feeling relief from it all and feeling File: unnamed1 jpg (822 KB, 3024x4032)

liberated. Godspeed anons and be safe with it, my treatment is not long term and you also need to take
Arginine and Ornithine to help your body combat the massive dump of ammonia when these little fuckers get
blasted

Anonymous (ID: = 10/08/21 (Fri)21:33:04 No.342646361 »

>>342626641 (OP)
Im on day 3 of walnut/wormwood/clove caps. Had a bunch of tiny white stringy things floating in toilet water after pooping.
Guess you guys were right, again.

Pol is always right.

|) Anonymous (ID: 6 ШЕЗШИӘ)) 21: 10/08/21 (Fri)12:59:05 No.342598536 >

>>342597038

You can get 90 wormwood pills for £7, | got the cheap plain ones (without black wallnut).
Genuinly did not expect anything and it to be another retarded /pol/ larp. but here | am 24h later
shitting out worms like a diseased lepper.

Also took 1/2tsp ground cloves mixed with water from the spice rack also as that suposedly helps
kill the eggs, read that its best to fresly grind whole cloves, but | only have the powdered stuff.

|] Anonymous (ID: «EIE SIS 10/08/21(Fri)00:31:02 No.342537880 |» >>342538103 >>342538144 >>342538261
le: unnamed. jpg (1.19 MB, 3024x4032)

>>342536146

>>342538144
Yeah | got a pic of this guy when | wiped my ass. There were several bigger ones in my
stool but | didn't fish them out. There were also lots of white balls which looked like eggs.

>>342538103
That is the human one. It worked really well and is strong.

C Anonymous (ID: 6 2242) == 10/08/21(Fri)14:34:45 No.342605182 »

okay so i have been taking ivermectin for 3 days now and last night i felt this rush and energy
after i took a shit that smelt like there were dead worms in it, i couldn't sleep right away and
woke up early did this happen to anyone else?

ГІ Anonymous (ID: vxdax4y@y) == 10/07/21 (Thu)23:47:33 No.342533211 >

22342531717

>within the fist week

Maybe not. | just started seeing them today on day 8 using the typical wormwood/walnut/clove remedy. |
started with pills but | also ordered a tincture that contains a few extra things and so | started taking some of
that on top of the pills yesterday and today | started actually seeing worms. I'm thinking maybe the tinctures
do work better, but also I'm 230lbs so it also occurred to me that might just need a larger dose. It's not like
these bottles say anything about dosing based on weight after all.

| drake a whole bottle of Reeses yesterday whcih is 1500mg Pyrantel. | shat out some C Anonymous (10: 4Мхбахауа)) M] 10/07/21(Thu)21:12:26 Мо.342515788 &
worms and feel great now. File: 1633456842578.png (1.4 MB, 1600x983)

Anonymous (ID: «а 10/07/21(Thu)21:14:06 No.342515977 »

22342515654
the only thing that helps me with stress is medication and long walks in nature. As well as the parasite pill. Psoriasis is way down, energy
and restfulness way up.

[| Anonymous (ID: Фа ЖЭЭ) == 10/07/21(Thu)18:37:31 No.342498786 >
le: 1633581832177 мет (2.86 MB, 640x352)

I've taken (4) doses of ivermectin (horse paste) spaced out over a span of 8 days.

I no longer have an erection when viewing homosexual pornography.

My energy levels have improved and i feel like i can actually get up in the morning

I have less body aches, and my mood is improved

I think i am going to try the wormwood/black walnut/clove combo to finish it off, after i
finish the rest of the ivermectin

Boon a lotta Racists online

tryna spread FAKE NEWS

164

22342514904
Yeah, many such cases. Here's a few relevant links if interested.

Parasites cause cancer:
https://files.catbox.moe/wupj3t.pdf

Things that kill parasites can also cure cancer:
https://youtu.be/HYILnjc wuY [Embed]

Man cures cancer with B17:
https://www.youtube.com/watch?v=hmkkwBTqVPc [Embed]
(((ҒОА))) shuts it down:

https://www. youtube.com/watch?v=gBQD9IRr6Ow [Embed]

| shit out my first clearly identifiable worms today on day 8 with wormwood/walnut/clove. Three little white stringy fuckers maybe half а
millimeter wide and about 1-2cm long. Was starting to think | wouldn't see any, but | really don't feel like straining and sifting through my
shit. Going to take a break after this, do a short 3-5 fast, then start on turpentine after. Then | might a round of ivermectin and a round of
fenbendazole after that (just because both are easy to obtain), followed by taking small amounts of turpentine regularly for maintenance.
One way or another I'm going to kill these little fuckers. Hopefully it helps with some mysterious health issues that started up for me in
recent years.

12. TREATMENTS
ANTIHELMINTHICS............. ————————— iei ———ÀXP ТЕРЕ .166

HERBAL TINCTURES...............-« op RR cs sccosecasesvusersecsusecssrscsesseesearseeseeneer 167
TURPENTINE............. АНИНЕ... ee 168
ZEOLITE CLINOPTILOLITE........................-- E TNA: қ.%...............169
INL COT NMR И. ЕЕККИКЕКЕКТЕНЕ mA A b... 170
СІЛТІ ҰЛА ЕНЕИКИИИИККИКЕКИКНЕКЕКЕКЕКИКЕКККЕНЕ к. ятһа А171
РВОВІӨТІСС...... ee nn An 8 172
ALCOHOL............. c жа —À ^ NE HW AM NEN 1.8172
FASTING............. cernentes Ed БИН яғ ^ M of M2174
TUA eoa. E a a A ne ae 174
FREEZING............... ener M және OST — /.А......174
MEDICINAL РІАМТ5.............. Шаа _ /.А...........!175
LIVER FLUKE TREATMENTS..0...scssssssssssssessesssssesssssssessssssssssssscsssessesssssessessseessessssesseseeL 75
МІТА2ОХАМІРЕ........................ Ma wu НЕ eee 176
BIOFILM TREATMENT S............... eren —— ЕТЕКТЕН КЕНЕ г).

SILVER. ЛЕТИЕ ЕРЕКЕ ЕКЕ CO E UE ERES IS

Treatments pdf: LINK

Herxheimer Reactions

As parasites die, they release toxins through their excrement and from rotting. The most common parasites, the worm type, attempt to escape by burrowing deeper into the
intestines, which can cause sharp cramps. Even when dead, the body is still burdened with the task of flushing them out. This whole process can make the person feel sicker
than he was before he began the cleanse, but this is only temporary, and it is a sign that the cleanse is working. It is known as a Herxheimer reaction when people become
sicker as a result of the toxins that are released by dying parasites. While fatigue and grogginess are to be expected, normal life may be continued, and diarrhea should not
occur. Eat a good, wholesome diet throughout the cleanse to ensure that your immune system is at its strongest. After the cleanse, you should feel better, have more energy,
and experience sickness less often.

165

ANTIHELMINTHICS

сазы

IVERMECTIN
етет) PASTE 1.87%

Anthelmintic & Boticide Apple Fla vored!
Removes worms and bots with a single dose. a

Net WE. 0.21 oz (6.08 g)
Cortes wi feat ср io 1250 b bocy er
ANADAR 200.928, Aged ty FOR

Abstract and Figures

Objective: Ivermectin and sulphadiazine were tested individually to determine their in vitro
effects on Toxoplasma gondii grown in human epidermoid larynx carcinoma (Hep-2) cell
culture. Study Design: In-vitro study. Material and Methods: Toxoplasma growth was
quantities by an enzyme immunoassay performed directly on the fixed cultures, using a
rabbit anti-T. gondii immunoglobulin G as the first antibody and a phosphatase-labeled anti-
rabbit immunoglobulin G as the second antibody. For each drug, regression models were
used to quantify the relationship between optical density values and antimicrobial agent
concentrations in the cultures. Results: The 50% inhibitory concentrations (1С50) of
ivermectin and sulphadiazine were found to be 0.2 ug/mL and 7.3 pg/mL after 48 h of
exposure, respectively. None of the concentrations tested for each drugs demonstrated
toxicity to Hep-2 cells after 72 h of incubation. Conclusion: These results indicate that
ivermectin significantly inhibited replication of the tachyzoites of T. gondii RH strain

Anonymous (ID: SmooOXqv4 ) [ll 10/30/21(Sat)18:35:52 No.345439600 |» >>345440176 >>345440246

22345438799
»ivermectin supposedly only works on the immature worms

Hey mexibro you have this wrong. Ivermectin works on adult worms, by interfering with their gaba receptors.
For you, add some abendazole (Vernox plus) to your anti parasitic regimen. Readily available in Mexico.

The antiviral property is something else, it is also an "n1 nuclear inhibitor" it prevents viruses from infecting the nucleus of your tcells. It's when they're infected , that they can't undergo mitosis and reproduce. That's how people with aids
lose their tcells / immunity and die.

So the anti parasitic and antiviral property of ivermectin work differently.
Ivermectin has no effect on eggs and nymphs. That's why you dose at like days 1,2,8,апа 30 and then regularly for a 2 day cycle at 6 months.
More aggressive for covid prophylaxis or if you have a permanent viral infection you're using it off label for like herpes or hiv.

Im hiv* and ditched my 3000/medicine for 6mg of ivermectin a day and I'm remaining undetectable for 3+ months

Ivermectin does not pass through the blood-brain barrier and so
has no effect on parasites which have entered the brain. Even
though it is the most effective anti-helminth on the market, it has
no effect on fungal parasites. If you believe you are infected with
a fungus, consider fenbendazole, which treats both helminths
and fungus. If you gain temporary relief from fenbendazole or
ivermectin, but your symptoms keep recurring, it is possible your
central nervous system has been infected. Mebendazole will
bypass the blood-brain barrier to treat such infections.

| |— . . Antihelminthic Therapeutic Agents and Indications for Their Use
Drug Effect Used for
Albendazole Blocks key step in worm metabolism Filariasis, ascariasis, strongyloidiasis, and some adult worms
Diethylcarbamazine Unknown but kills microfilariae Filariasis, loiasis
Ivermectin Blocks nerve transmission Onchocerciasis, ascariasis, strongyloidiasis
Mebendazole Blocks key step in worm metabolism Trichuriasis (whipworm), ascariasis, hookworm, trichinosis

Metrifonate Paralyzes worm Schistosomiasis

Niclosamide Inhibits ATP formation in worm; destroys proglottids Tapeworm
but not eggs

Niridazole Alters worm metabolism Schistosomiasis
Piperazine Paralyzes worm so it can be expelled in feces Ascariasis, pinworm, hookworm
Praziquantel Interferes with worm metabolism Schistosomiasis, other flukes, tapeworm

Pyrantel Paralyzes worm so it can be expelled in feces Pinworm, hookworm, trichinosis

Thiabendazole Blocks key step in worm metabolism Strongyloidiasis, guinea worm, hookworm trichinosis

166

HERBAL TINCTURES

* Black Walnut Hulls (from the black walnut tree)
“ Wormwood (from the Artemisia shrub)
“ Common Cloves (from the clove tree)

These three herbs must be used together. Black walnut hull and wormwood kill adults and developmental stages of at least 100
parasites. Cloves kill the eggs. Only if you use them together will you rid yourself of parasites. If you kill only the adults, the tiny
stages and eggs will soon grow into new adults. If you kill only the eggs, the million stages already loose in your body will soon grow

into adults and make more eggs. They must be used together as a single treatment.

Anise Honey
Ashwaganda M. Pudica
Astragalus Mirnosa Public
Barbary Root Mullein
Berberine Moringa (moringa oleifera)
Black Walnut Neem | с,
Cayenne Pepper Nettle Black Walnut
Capsaicin Olive Leaf Wormwood
Carrots Oregano Oil Complex
Cascara Oregon Grape Herbal Supplement
Clove Oil Papaya Seeds Rowe TI OZ. (59 rM
Coconut Oil (for candida) Pau D’Arco ші іш,
Curaco Propolis
Curled Mint Pumpkin Seeds

ParaGuard” Epazote Raspberry Leaf
Fennel Seed Sage
Garlic Tansy
Ginger Thyme
Goldthread Triphala
Goldenseal Turmeric
Grapefruit Seed Extract Vidanga
Holy Basil Wormwood

Conclusion: These results show that although M. pudica has weak anthelmintic effects compared to
albendazole (standard anthelmintic), in vivo and in vitro, at the doses used in this study, nonetheless, it
reduces worm burden and improves haematologic parameters, serum total protein, albumin and overall
weight gain of the treated mice. Thus, increased doses may be effective in anthelmintic chemotherapy.

@ academic.oup.com/femsle/article/367/23/fnaa194/6000212
Effect of capsaicin on the protozoan parasite
Trypanosoma cruzi <>

Edward A Valera-Vera, Chantal Reigada, Melisa Sayé, Fabio A Digirolamo,
Facundo Galceran, Mariana R Miranda, Claudio A Pereira &

FEMS Microbiology Letters, Volume 367, Issue 23, December 2020, fnaa194,
https://doi.org/10.1093/femsle/fnaal94
Published: 24 November 2020 Article history v

PDF MsSplitview 66 Cite # Permissions «$ Share v

ABSTRACT

Trypanosoma cruzi is the causative agent of Chagas disease. There are only two
approved treatments, both of them unsuitable for the chronic phase, therefore
the development of new drugs is a priority. Trypanosoma cruzi arginine kinase
(TcAK) is a promising drug target since it is absent in humans and it is involved
in cellular stress responses. In a previous study, possible TcAK inhibitors were
identified through computer simulations resulting the best compounds
capsaicin and cyanidin derivatives. Here, we evaluate the effect of capsaicin on
TcAK activity and its trypanocidal effect. Although capsaicin produced a weak
enzyme inhibition it had a strong trypanocidal effect on epimastigotes and
trypomastigotes (ІС. = 6.26 рМ and 0.26 uM, respectively) being 20-fold more
active on trypomastigotes than mammalian cells. Capsaicin was also active on
the intracellular cycle reducing by half the burst of trypomastigotes at
approximately 2 uM. Considering the difference between the concentrations at
which parasite death and TcAK inhibition occur, other possible targets were
predicted.

Capsaicin is a selective trypanocidal agent active in nanomolar concentrations,
with an IC... 57-fold lower than benznidazole, the drug currently used for
treating Chagas disease.

pubmed.ncbi.nlm.nih.gov/

Evaluation of the anthelmentic activity of garlic
(Allium sativum) in mice naturally infected with
Aspiculuris tetraptera

Erol Ayaz , Idris Türel, Abdurrahman Gül, Orhan Yilmaz

Affiliations + expand
PMID: 18673129 DOI: 10.2174/157489108784746605

Abstract

This study was performed to investigate the anthelmentic (nematodes) effect of garlic in Swiss albino
mice naturally infected with Aspiculuris tetraptera. Natural infection was determined by the use of
cellophane tape method on the perianal region and by the technique of centrifugal flotation of stool
samples. The infected mice were divided into three groups; namely, Group 1: garlic treatment groups
(n: 18), Group 2: positive control (treated with ivermectin, n: 19) and Group 3: untreated control group
(n: 19). The mice in Group 1 were given orally freshly crushed garlic homogenates every day for 7
days. The animals in Group 2 were treated with ivermectin intramuscular at a dose of 0.2 mg/kg body
weight. The mice in Group 3 received only serum physiologic orally. After 8 days of administrations, all
mice were killed humanely using inhalation anaesthesia and then the parasites in the intestine were
counted. It was observed that
tetraptera I naturally infected mice, respectively. Results obtained from this study were compared
statistically and differences were found to be significant (p<0.001). It was found that garlic was
efficient along the duration of the treatment in mice. Garlic may be useful as an alternative treatment
against nematode parasites in animals and human. This article includes a new research using Allium
sativum anthelmentic effect on mouse and has been patented.

167

TURPENTINE

Tree Resins [Pine Gum spirits] and Castor Oil
Turpentine: LINK

It is important to use the turpentine which is labeled ‘Pine Gum Spirits’ and is made from
distilled pine tree sap, and not the turpentine found in hardware stores which is a toxic
solvent made from petroleum distillates and used as paint thinner.

E

N

[2]

|

—-|o N nje
a a A
w [^] [^]
= = ok

=à | «а
WIN
a
[^]
=

= | os
nje

=
o
e
e
=

№ |= | |
о [Ф [Ф| ~
21]
w
m

N
pg

N
N

N
Co

Oh yeah, and #4

>Castor oil
Castor oil taken orally with 1 cup of coffee and some honey. Castor oil is the most potent purgative on Earth and it fucking NUKES the parasites. Destroys their biofilm too so
they slide off the colon wall. The honey further acts as a lure.

The castor oil needs to be cold pressed and bought from a legit source. Potency is key.

If you're loaded with fungus (99% of us are), you will feel like the black death itself after taking this substance.
22 tbsp of castor ой

71 tbsp of honey

>1 cup of coffee, light roast organic

Then you wait 5 hours and do a coffee enema ala Max Gerson-style, this is very important or you won't finish the expulsions and you'll still feel incredibly ill. To finish
>1 liter of coffee, light roast organic

>2 tbsp of castor oil

>2 capsules of ox bile, removed from capsule and dumped into solution

>rub ORGANIC castile soap into solution for a few moments

This creates a suspension of liposomal castor oil which will purge every last fucking thing in your colon. Stir continuously as it enters you as the castor oil will rise to the top of your enema bucket.
Try to hold for as long as possible then prepare for the greatest and unholiest bowel movement of your life.

I'm not kidding you anons when | say this nukes EVERYTHING. But it's selective, only the bad shit goes.

When you expel the solution, expect extreme burning in your asshole. This only happens the first few times you do this, as the liposomal castor oil literally pulls out the deepest poisons lodged in
your system from childhood onwards and finally ejects them.

Do this every other day while fasting and | guarantee you, within two weeks you'll feel invincible. And you will be, compared to those around you.

168

ZEOLITE CLINOPTILOLITE

Zeolites are porous minerals with high absorbency and ion-exchange
capacity and are an excellent detoxifying, antioxidant and anti-
inflammatory agent.

Could Antiparasitic Cure with Clinoptilolite be Achieved in Dogs
Naturally Infected with Giardia Duodenalis?

Adnan AYAN*!, Songül ERDOGAN?

"Van Yusuncu Yil University, Faculty of Veterinary Medicine, Department of Genetics, 65080, Van, Turkey
2Adnan Menderes University, Faculty of Veterinary Medicine, Department of Internal Medicine, Aydin, Turkey

ABSTRACT
The aim of this study was to determine the antiparasitic efficacy of the natural zeolite component, clinoptilolite,
against naturally occurring giardiasis in dogs. Seven infected dogs, aged 6-44 months of age, both sexually owned
and diarrhea infected with Giardia duodenalis in the Aydin region were used in the study. Group I was administered
clinoptilolite orally for 10 days at a dose of 2 g / kg. Group II dogs were provide to stay in the control group. The
antiparasitic efficacy of clinoptilolite in dogs was evaluated by microscopic examination of stool samples collected
at the beginning 0, 3rd, 7th and 10th day by rectal route. Considering the reduction in cyst excretion per gram
feces, clinoptilolite used for anti-giardial purposes provided 99% efficacy in cyst excretion at 10th day. In the
treatment group, the mean geometric averages of cyst counts were determined as 200552.4, 37.8, 113.3, 10.4,
respectively, on days 0, 3,7 and 10. On the other hand, in the control group, no significant change was observed
in the geometric mean of cyst ruble excretion on day 0 (195099,4) 10 days (174436,1). It can be said that
clinoptilolite effectively decreases cyst excretion in dogs with giardiasis and can be used in the recommended dose

wi i 7 si ffects.
without causing any side effect [) Protocol master 03/12/22(Sat)12:42:17 No.31249675 |.2>>31249889 >>31251310

le: 20404.jpg (2.04 MB, 2677x3189)

The best method for removing them is as follows.

>Zeolite, Clinoptilolite, 90%+ purity, activated, in powder form
»Coffee, light roast, non-ETO, organic

You take two tablespoons of zeolite (with a plastic'wooden spoon) four times а day, mix it with
RO/distilled water.

You take four coffee enemas a day. You boil 1 quart of water, add three tablespoons of coffee, boil it for 5 mins, simmer for
15, wait for it to cool to body temperature or add no more than 1 extra quart of water to cool it.

Putit in a stainless steel enema bucket with a non-plastic tube (silicone pref), lay on your right side and hold it for 15
minutes.

If this is your first time, you will not be able to hold it. Instead, take 3 quarts of warm water and expel until your expulsions
are mostly clean. Then re-attempt the coffee enema.

|) Protocol master 03/12/22(Sat)12:55:59 No.31249766 | 2>>31249889
le: zeolite.png (136 KB, 850x363)

HEILTR()PFEN r ВЯ
В . mam u i
Zeolite Clinoptilolite
li лашка Спіс d powder The zeolite is an aluminosilicate mineral with a rigid anionic framework containing well-defined

3xTMA micronized.
Particle sizes range from 0.32 to 1.36 pm.
Glinoptilol (Tribo-mechanical activated)

Net. Wt.: 0.551Ь (250g) С

channels and cavities. It has negatively charged ions that bind to positively charged molecules. It has a honeycomb
structure which encases positively charged molecules, of which most are harmful in nature.

In layman's terms, it is able to bind to -- trap - and eliminate toxins, parasites, and heavy metals. This has been studied
extensively. It is also used at nuclear disaster sites to absorb radiation.

It is the most powerful detoxifying substance known to man, apart from maybe glutathione and R-lipoic acid. It is certainly
the most functional method for detoxification in that it traps and removes all three major causes of disease.

heiltropfen.com

It does not kill parasites. It embalms them, then buries them alive. It traps toxins. And it traps heavy metals. By it's natural
attraction to heavy metals, all parasites are removed in the process.

The coffee enema dilates the bile ducts. The caffeine in the coffee irritates the liver, which is stimulated to release it's
accumulated toxins. The liver is the foremost detoxifying organ in the body. The coffee directly aids this process, allowing
you to detoxify when fasting far quicker. Around 3x faster in my experience. What may take hours for your liver to process
is instead dumped back into the colon where it is quickly excreted with the coffee.

Bile production is also stimulated, and gallstones are released. The bile also compounds with the zeolite to effectively
annihilate the parasites.

This protocol is cheap, extremely effective, and scientifically sound. You do not need to buy expensive herbs or
supplements. Just two items are required. Water fasting is obligatory in this process. You can expect to see expulsions
begin en masse within two days.

Parasites are attracted to heavy metals. Especially mercury. Remove it from your body and the parasites will go to. I've
expelled dozens of parasites using these herbs, but my gut was still huge and | was still unhappy. | had to spend
thousands of dollars on it all.

Then you take zeolite and coffee enemas. Boom. Thousands upon thousands of worms, flukes, candida and the like
comes out in a tidal wave. It smells like a demon. It is the worst smell you can possibly imagine. A metallic smell, rotting
flesh, and sulfur is the best description. Even smelling it is enough to make you feel ill.

That's just the first wave too. Then you see the black goo come out. Somehow smells even worse. If you do it right though,
the bile dissolves the goo and it becomes gooey instead of rubbery. Gallstones come out too. It is a religious experience
and makes you scoff whenever some unenlightened pleb calls it "pseudo-science" or "quackery".

That's why you should only take those two substances too, because there can be no doubt in your mind that it is real.

169

NICOTINE

Nicotine kills parasites and bypasses the blood-brain barrier, making
it one of the most effective methods for removing brain parasites.
By killing brain parasites, it removes the inflammation in the brain,
eliminating brain fog and causing it to be considered a nootropic. It
also balances out hormones (raising testosterone) by removing the
parasites which are disrupting hormone production when they infect

the many glands found in the brain. Nicotine, by itself, is non- in ^
addiction forming when used in low doses; however, most people Nicotine
get nicotine from tobacco cigarettes, which almost always use harsh Lozenges
chemicals during processing. These chemicals act as food for para- Nicotine ae
sites and can lead to cancer in the lungs (if smoking the tobacco) or Stop Smoking Aid

in the throat (if chewing). It is these chemicals which causes ciga- THEIR FIRST CIGARETTE WITHIN

rettes to be addictive due to the parasites using the chemicals as a you smoka yar A sm
food-source. For all of these reasons, smoking and chewing tobacco eim m
should be avoided unless one grows and processes his own tobacco.
The one exception to this is Snus, which does not seem to contain
the chemicals. Even if the chemicals are somehow avoided, the ash
from smoking can also cause significant lung problems, and so one
should limit one's tobacco smoking by using pipes (not cigarettes) in
well ventilated areas (to avoid second-hand smoke from the pipe).

CANNABIS

Cannabis reduces inflammation which causes pain by killing the worms that cause inflammation, but there
are several studies linking extended cannabis use to brain damage. As a result, cannabis ought to be avoided
as an anti-parasite treatment. LINK1 LINK2

SULFUR

Sulfur for the control of veterinary parasites

veterinary medicine, and also against domestic pests.

Nowadays it is still used in agriculture (e.g. in wine and fruit growing), often in integrated
programs together with other organic pesticides. Usage against veterinary parasites is
irrelevant.

So far there are no reports on parasite resistance to sulfur, which is not surprising considering its very scarce
veterinary use.

DMSO, Antabuse, and Methylsulfonylmethane (aka: MSM or DMSO2) are all derivatives of Sulfur.
They function in ways similar to sulfur but are generally considered safer to consume.

ANTABUSE AND ETHYLALCOHOL

B. Toxicity.

Microorganisms are comparatively sensitive to Antabuse. A
0.1% emulsion in water containing 10% alcohol is bacteriostatic
for staph. aureus at dilutions of 1:8000—1:16000, giving a final
concentration of not more than 1:8 х 10* — 1:16 x 108. Even
worms are sensitive to this substance. In vitro trichuris leparis
is killed after 1 hour at 37° with 100 mg % tetraethylthiuram-
disulphide in Ringer’s solution containing 2% alcohol. An in-
take of 0.25 g Antabuse daily for 4—6 days is able to free rab-
bits completely from parasite eggs in the faeces. Tetraethyl-
thiuramdisulphide has, moreover, been used as a scabieticide
with some effect (HAMMARSKJÖLD, 1943; Boas and LAUSTEN
HANSEN, 1945).

The high toxicity in lower animals is presumably due to the
capacity of Antabuse to form complex compounds with copper.
Copper enzymes essential to the metabolism of these animals
are thereby blocked.

The compound possesses a, very low grade of toxicity for mam-
mals. In puppies and rabbits the fatal oral dose was found to be

171

PROBIOTICS

Ê https://pubmed.ncbi.nlm.nih.gov/31662635/
The Anti-parasitic Effect of Probiotic Bacteria via
Limiting the Fecundity of Trichinella Spiralis Female
Adults

1

В Bucková *, Z Hurniková 1, A Lauková 2, V Revajová 2, E Dvorožňáková !

Affiliations + expand
PMID: 31662635 PMCID: PMC6799552 DOI: 10.2478/helm-2018-0010
Free PMC article

Abstract

ҰС: Ергоіесінуе effect of probiotic strains against zoonotic Trichinella әрігай infection was
investigated in the framework of a new therapeutic strategy aimed at using probiotics to control
parasitic zoonoses. The study was focused on the impact of six selected probiotic (bacteriocinogenic)
strains on the intensity of T. spiralis infection and female fecundity ex vivo and in vitro. Bacterial strains
of different origin (Enterococcus faecium EF55, Enterococcus faecium 2019 = CCM7420, Enterococcus
faecium AL41 = ССМ8558, Enterococcus durans ED26E/7, Lactobacillus fermentum AD1 = ССМ7421,
Lactobacillus plantarum 171/1) were administered daily іп a dose of 109 CFU/ml іп 100 pl, and mice
were infected with 400 T. spiralis larvae on day 7 of treatment. Female adults of T. spiralis were
isolated on day 5 post infection (p.i.) and subsequently were used in fecundity test ex vivo. Е. faecium
ССМ8558, E. faecium ССМ7420 and E. durans ED26E/7 strains significantly reduced the number of
adults in the intestine. The application of L. fermentum ССМ7421, L. plantarum 17L/1, E. faecium
ССМ8558 and Е. durans ED26E/7 caused a significant decrease in the number of muscle larvae. The
treatment with E. faecium ССМ8558 and E. durans ED26E/7 showed the highest inhibitory effect on
female fecundity (94 $). The number of newborn larvae (NBL) was also significantly decreased after
administration of L. fermentum CCM7421 and L. plantarum 17L/1 (80 ?5). A direct impact of probiotic
strains on female reproductive capacity was examined in vitro in females isolated from untreated
infected mice on day 5 p.i. A correlation was found between the inhibitory effect and the
concentration of probiotic strains. The reduction effects of the strains manifested as follows: L.
fermentum CCM7421 (93 $), E. faecium ССМ8558, L. plantarum 17L/1, E. faecium EF55 (about 80 $), E.
faecium ССМ7420 and E. durans ED26E/7 (about 60 %).

| Anonymous (ID: (@at6GHVA) == 09/28/21(Tue)16:49:43 No.341299055 |» >>341299456 >>341299840 >>341300265 >>341304920

22341269537
so the entire cause of societal degradation is parasites. So in the Weimar republic when children were being prostituted that was due to parasites, then Hitler eventually came
to power and as we all know dispensed ivermectin and everything was fixed. Not like there was any other cause of societies ills.

| Anonymous (ID: ҮШТІ) = 09/28/21(Tue)16:56:03 No.341299840 »

22341299055
Sauce on Hitler deworming process? Never seen that anywhere can't find it.

Anonymous (ID: 4OWMIFBAD) == 09/28/21(Tue)17:35:18 No.341304920 » >>341305191

27341299055
strangely enough, probiotics can help with parasite infestations, and we all know that sauerkraut is the #1 probiotic in the world. | assume that the krauts just dewormed
themselves once the jews were prevented from continuing to spread parasites. hitler did stop the jews from mandating the jew vaxes.

Anonymous (ID: &GVIMIFBA) = 09/28/21(Tue)17:37:27 No.341305191 |» >>341310205
: 1627275866914 jpg (11 KB, 225x225)

77341304920
https-//pubmed.ncbi.nlm.nih.gov/31662635/

| mean, it all makes sense. the germans accidentally dewormed themselves by just getting rid of the jew vaccines. anons, we
are on to something...

Anonymous (10: (СШ?) = 09/28/21(Тие)18:17:05 No.341310205 > >>341311691 >>341312511
: 1632866549232 jpg (99 KB, 1024x751)

27341305191
Making Sauerkraut right now. Little demons never stood a chance.

172

ALCOHOL

Spl Science Daily

https://www.sciencedaily.com

2 2012 — Alcoholic drinks aren't generally put
into the category of health food, but in some cases
they might be just the cure for nasty parasites.

The gut worms which lower testosterone and turn people into homosexuals can be killed with alcohol, par-
ticularly with hard alcohol, but the alcohol also harms your blood-brain barrier, making you more likely to
become chronically infected by brain parasites that cause depression, addiction, and neurological problems.
This is why alcoholics tend not to be pussies or faggots, but they do tend to get depressed a lot and suffer
from many kinds of addictions. It is best to avoid alcohol altogether in lieu of other treatment options.

799986/

pubmed.ncbi.nim.nih.gov/33

Alcohol-Induced Blood-Brain Barrier Impairment:
An In Vitro Study

Donatello Carrino 1, Jacopo Junio Valerio Branca *, Matteo Becatti 2, Ferdinando Paternostro 1
Gabriele Morucci 3, Massimo Gulisano 1, Lorenzo Di Cesare Mannelli 4, Alessandra Pacini 1

Affiliations + expand
PMID: 33799986 PMCID: PMC7967408 DOI: 10.3390/ijerph18052683
Free PMC article

Abstract

In recent years, alcohol abuse has dramatically grown with deleterious consequence for people's
health and, in turn, for health care costs. It has been demonstrated, in humans and animals, that
alcohol intoxication induces neuroinflammation and neurodegeneration thus leading to brain
impairments. Furthermore, it has been shown that
(BBB), but the molecular mechanisms underlining this detrimental effect have not been
fully elucidated. For this reason, in this study we investigated the effects of alcohol exposure on a rat
brain endothelial (RBE4) cell line, as an in vitro-validated model of brain microvascular endothelial
cells. To assess whether alcohol caused a concentration-related response, the cells were treated at
different times with increasing concentrations (10-1713 mM) of ethyl alcohol (EtOH). Microscopic and
molecular techniques, such as cell viability assay, immunofluorescence and Western blotting, were
used to examine the mechanisms involved in alcohol-induced brain endothelial cell alterations
including tight junction distribution, apoptosis, and reactive oxygen species production. Our findings
Clearly demonstrate that alcohol causes the formation of gaps between cells by tight junction
disassembly, triggered by the endoplasmic reticulum and oxidative stress, highlighted by GRP78
chaperone upregulation and increase in reactive oxygen species production, respectively. The results

from this study shed light on the mechanisms underlying alcohol-induced blood-brain barrier
dysfunction and a better understanding of these processes will allow us to take advantage of
developing new therapeutic strategies in order to prevent the deleterious effects of alcohol.

173

FASTING

Fast for 72 hours and not a minute less. This kills off your white
blood cells forcing them to regenerate after the fast. In nature
animals naturally fast for periods, so it is built into your biology to
expect it. When you never fast, you are operating your body in an
unnatural state and your white blood cells never get a chance to
reset as they should.

Less than 72 hours isn't enough. Much more doesn't seem to be
necessary. LINK

BAKING SODA

Baking soda is also an effective natural remedy for
parasitic worms which can infest the digestive tract.
Before bed, dissolve a quarter teaspoon of soda in
warm water and drink. Repeat every night for three days

America’s 4 to remove parasites from the body.

#1 Trusted Baking Soda Brand

GE |

Baking 504)

icarbonat | de 54

FREEZING

by y irradiation (Dubey et al. 1986). These data are now used by
regulatory agencies to advise consumers about the safety of meat.
Freezing of meat overnight in a household freezer before human
or animal consumption remains the easiest and most economical
method of reducing transmission of T. gondii through meat.

MEDICINAL PLANTS

Toxoplasmosis and anti- Toxoplasma effects of

https://www.sciencedirect.com/science/article/
pii/S1995764516301298

medicinal plant extracts-A mini-review
Ibrahim Al Nasr 1» ? 9 14, Faiyaz Ahmed 2, Fawaz Pullishery ?, Saeed El-Ashram % 5, Vardharajula Venkata Ramaiah 2

able 1
ledicinal plants used for the treatment of various parasitic infections, including 7. gondii.
Parts used

Stem and leaves
Stem and leaves
Stem and leaves

Extraction method

Air-dried, powdered and ethanolic extract
Air-dried, powdered and ethanolic extract
Air-dricd, powdered and cthanolic extract

Plant name

Vernonia colorata
Zingiber officinale
Sophora flavescens

Stem and leaves
Roots

Torilis japonica
Eurycoma longifolia
Calotropis procera

Air-dried, powdered and ethanolic extract
Air-dried, powdered and methanolic extract
Air-dried, grounded and ethanolic soak

Pulicaria crispa Air-dried powdered and methanolic extract

Euphorbia retusa Dried at room temperature, powdered
and methanolic extract
Air-dried methanolic extract

Air-dried chloroformic extract

Rumex spinosa

Leaves and flower Air-dried powdered and methanolic extract

Lycium shawii Leaves Oven-dried, grounded and methanolic extract

Stem and leaf Air-dried ethanolic extract
(olco-gum resin)
Stem and leaf
Stem and leaf

Commiphora
Molmol (Myrrh)
Curcuma longa
Juniperus procera

Air-dried, water and ethanolic extracts
Air-dried ethanolic extract

LIVER FLUKE TREATMENTS

Praziquantel

Generic name: praziquantel [ PRAZ-i-KWON-tel 1
Brand name: Biltricide

Dosage form: oral tablet (600 mg)

Drug class: Anthelmintics

d by Drugs.com on Feb 1, 2022. Written by Cerner Multum.

Before taking | Side effects ^ Interactions | Dosage

What is praziquantel?

Praziquantel is used to treat infections caused by schistosoma worms, which enter the body through
skin that has come into contact with contaminated water. Schistosoma worms are found in Africa, South

175

Biological effect

Anti-toxoplasmic activity
Anti-toxoplasmic activity
Anti-toxoplasmic activity

Anti-toxoplasmic activity
Anti-toxoplasmic activity
Anti-malarial effect

(Compound CP1-04-61)
Anti-cancer and anti-malarial
activity and growth inhibition of
wheat-rootlet activities
Anti-bacterial activity

Anti-fungal (Candida Albicans)
Anti-fungal (Alternaria alternata and
Saccharomyces cerevisiae)
Anti-malarial, Anti-lcishmanial,
Anti-trypanosomal and
hypocholesterolemic effect
Hypoglycemic, antiplasmodial

and antitrypanosomal effect
Anti-toxoplasmic activity

Anti-toxoplasmic activity
Anti-toxoplasmic activit:

DM

Nitazoxanide 500mg
18 fim coated toblets

Intestinal Antiprotozoal

References

Benoit-Vical F et al ^!
Choi KM et al ^"

Choi KM ег al 27 and
Youn HJ '*!

Youn HJ **!

Kavitha М et al ^?!

Mudi SY and Bukar A '*!

Gouda ҮС et al ' and
Sathiyamoorthy P et al 22!

Refahy LAG 52

Mandeel Q and Taha A /4!

Mothana RA et al 2!

Alkuwari AD et al ^!
Al-Zanbagi NA 1749!

Al-Zanbagi NA 199201
Al-Zanbagi_ NA 221!

Fluke1
Fluke2

Nitazoxanide 100mg/5ml

Powder for oral suspension

LE

THE rt YOU DESERVE

NITAZOXANIDE

In the following link is a list of "anti-viral" agents which are approved or under evaluation for the treatment
of Covid. The third drug listed is Nitazoxanide.
>https://www.covid19treatmentguidelines.nih.gov/tables/table-2e/

Upon further digging it turns out that NITAZOXANIDE is a dewormer and anti-parasitical.
>https://www.medchemexpress.com/nitazoxanide.html
>https://www.sciencedirect.com/science/article/abs/pii/S0014489416301746

It is an effective treatment for Cancer.
»https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6382696/

Also, since it treats Cancer effectively, it must treat fungal infections...which it does.
>https://link.springer.com/article/10.1007/s13258-020-00958-0

Again we see the link between anti-virals also being anti-parasiticals and anti-fungals. We see yet again that
these drugs which treat parasites, yeast and viruses also cure the incurable diseases. It was also originally
used to get rid of tapeworms.

>https://en.wikipedia.org/wiki/Nitazoxanide

Which begs the question, what is going on in the body with these drugs that they broad-spectrum kill para-
sites, yeasts, viruses, harmful microbes and so on? HCQ does this, Fenbendazole does this as well, as does a
myriad of herbs like wormwood, neem, epazote, soursop, cloves, walnut leaves and so on. Is there some
function in the body we are not yet aware of that these herbs and drugs support? And why does the media
seek so desperately to hide all of this information from us?

S pax 4
i "|
§ paxo p

-—
a ne
—

жене

History [edit]

Nitazoxanide was originally discovered in the 1980s by Jean-Francois Rossignol at the Pasteur Institute. Initial studies demonstrated activity versus tapeworms. [n vitro studies
demonstrated much broader activity. Dr. Rossignol co-founded Romark Laboratories, with the goal of bringing nitazoxanide to market as an anti-parasitic drug. Initial studies in the
USA were conducted in collaboration with Unimed Pharmaceuticals, Inc. (Marietta, GA) and focused on development of the drug for treatment of cryptosporidiosis in AIDS.
Controlled trials began shortly after the advent of effective anti-retroviral therapies. The trials were abandoned due to poor enrollment and the FDA rejected an application based on

uncontrolled studies.

Subsequently, Romark launched a series of controlled trials. A placebo-controlled study of nitazoxanide in cryptosporidiosis demonstrated significant clinical improvement in adults
and children with mild illness. Among malnourished children in Zambia with chronic cryptosporidiosis, a three-day course of therapy led to clinical and parasitologic improvement and
improved survival. In Zambia and in a study conducted in Mexico, nitazoxanide was not successful in the treatment of cryptosporidiosis in advanced infection with human
immunodeficiency virus at the doses used. However, it was effective in patients with higher CD4 counts. In treatment of giardiasis, nitazoxanide was superior to placebo and

comparable to metronidazole. Nitazoxanide was successful in the treatment of metronidazole-resistant giardiasis. Studies have suggested efficacy in the treatment of cyclosporiasis,

isosporiasis, and атеЫіаѕіѕ. 129! Recent studies have also found it to be effective against beef tapeworm(Taenia saginata). 26!

176

BIOFILM

planktonic stage aggregation recruitment and growth mature biofilm
& ncbi.nlm.nih.gov/pmc/articles/PMC3585461 /*ref1

Most bacteria form biofilms, which are multicellular microbial communities embedded in a self-
produced exopolymeric substance (EPS) largely composed of a protein anchor and different
extracellular polymers. Bacteria within a mature biofilm community exist in an altered metabolic state
and different physical environment than their free-floating, or planktonic, relatives. Biofilm bacteria
generally tolerate antibiotic treatment 2 and antibiotics can induce biofilm formation.

But killing the tapeworm larvae still might not end your tapeworm disease! A few varieties of tapeworms, like Echinococcus
multiocularis, have larvae inside their larvae! An even those second generation larvae can have more larvae inside them. These
internal larvae are shielded from all things that might harm them.

@ pubmed.ncbi.nlm.nih.gov/25594287/

Prevention of microbial communities: novel

approaches based natural products

George D Mogosanu, Alexandru M Grumezescu, Keng-Shiang Huang, Ludovic E Bejenaru
Cornelia Bejenaru *

Affiliations + expand

PMID: 25594287 DOI: 10.2174/138920101602150112145916

8 nsfgov/discoveries/disc summ jsp?cntn id-3001138&0rg -NSF&from-news

Parasitic worms have armies, produce more soldiers when needed

Abstract

Firmly attached to different living or non-living, solid or fluid surfaces rich in nutrients and moisture,
microbial biofilm is a matter of great interest due to its major importance for the healthcare
community. Depending on common strategies such as mutual protection and hibernation (quiescent
bacteria), the resistance, survival and virulence of microbial communities have large implications for
human pathology, clinical environment and biomedical devices. The microbial biofilm is continuously
changing, stimulating inflammation, increasing vascular permeability and preventing the action of
macrophages. About 8096 of human infections affecting the gastrointestinal, genitourinary and
respiratory systems, oral mucosa and teeth, eyes, middle ear and skin are caused by biofilm-
associated microorganisms. Therefore, the search for modern strategies is even more important as
microbial biofilms resistant to conventional antibiotics, antiseptics and disinfectants are involved in
the frequent treatment failures of some chronic inflammatory diseases and wounds. Natural products
containing secondary metabolites, such as aromatic compounds, sulphurated derivatives, terpenoids
(essential oils) and alkaloids as quorum-sensing inhibitors and biofilm disruptors, are promising
alternatives for the prophylaxis and treatment of chronic infections. Surface modification of medical
devices with non-polar functionalized nanoparticles stabilizes the natural compounds antibiofilm
activity and inhibits microbial adhesion and biofilm formation and growth for a longer period of time.
In this regard, an interdisciplinary approach is needed due to the large number of natural derivatives
alone or in combination with biocompatible and biodegradable micro-/ nano-engineered materials.

Biofilm is like a fortress for parasites. Adding layer upon layer, parasites create a growing colony inside of
your body similar to how an ancient city built a protective wall around it, only to later expand beyond the
wall and then build another protective wall around the new section of the city, only to then expand beyond
that, and etc. To capture the city, the attackers (white blood cells and deworming meds) must take each
wall down, one-by-one. Even if all free roaming parasites are irradicated by deworming treatments, if any
section of the biofilm remains, then the parasitic infection will also remain.

177

BIOFILM TREATMENTS

DiatomaceousEarth DE10, 100% Organic
Food Grade Diamateous Earth Powder - Safe
For Children & Pets 10 LBS

жебе: ~ 20,401

$19.99 & FREE Shipping

Diatomaceous earth is probably the best natural anti-parasitic medication. It is a natural pesticide that does not harm humans or pets. It is believed to kill insects, worms, and
parasites by dehydrating them. When used on ants, it usually takes approximately 20 minutes before they are all dead. One tablespoon of diatomaceous earth taken by an
adult, once a day for a week, is believed to be extremely effective for killing all parasites. When it is used on children, bear in mind that height is a better indicator of the size
of their gastrointestinal tracts than their weights. Thus, a child who is 4 feet tall should take 2 teaspoons, and a child who is 2 feet tall should take 1 teaspoon.

Our research indicates that diatomaceous earth is the best overall parasite treatment for humans, because it can kill blood-borne parasites as well. When using it, be sure to
drink plenty of fluids, because it will dehydrate a person considerably. If you take the diatomaceous earth route, then we advise you to only buy it food grade. Industrial
diatomaceous earth is used for swimming pool filters, and it has been chemically treated, so this type is not safe to eat. Try to avoid rubbing it onto your hands, since it will
have a drying effect upon the skin. Mix the powder into a drink before consuming, in order to avoid inhaling any of the dust.

Diatomaceous earth contains heavy metals as part of its mineral content, but it also contains selenium, which allows otherwise accumulative heavy metals to be safely
flushed from the body. Therefore, it is not really a health concern, despite the trace presence of aluminum and lead. We recommend taking selenium supplements for a week
after discontinuing this treatment to ensure that the body thoroughly neutralizes the metals. Concerned individuals can follow the parasite cleanse with a metal cleanse.

Bragg Organic Apple Cider Vinegar With the
Mother- USDA Certified Organic - Raw,
Unfiltered All Natural Ingredients, 16 ounce
ЖЖЖ ~ 51

$12.99 & FREE Shipping on orders over $25.00 s...
12 Used & New from $12.49

=
ж

Liver Flush:

178

SILVER

ncbi.nim.nih.gov/pmc/articles/PMC68 158

Nanosilver Colloid Inhibits Toxoplasma gondii Tachyzoites and Bradyzoites in Vitro

Saeedeh SHOJAEE, !” Nima FIROUZEH,' Hussein KESHAVARZ 122 Sanaz JAFAR-POUR AZAMI,
Mahboobeh SALIMI,’ and Mehdi MOHEBALI'?

* Author information > Article notes » Copyright and License information Disclaimer
Abstract
Background:

Toxoplasma gondii, the coccidian protozoan parasite with worldwide distribution, is the agent of
toxoplasmosis. The disease is life threatening in congenital form and in immunocompromised patients.
The present study was carried out in 2016 to evaluate the in vitro effects of nanosilver colloid on
tachyzoites and bradyzoites of T. gondii, RH and Tehran strains.

Methods:

Different concentrations (5, 10, 20 ppm) of nanosilver colloid were added to tachyzoites of T. gondii,
RH strain (type I) and bradyzoites and tissue cysts of T. gondii, Tehran strain (type II) and incubated for
30, 60, 90 and 120 minutes. The mortality rates of tachyzoites and bradyzoites were evaluated by
trypan blue dye and MTT assay. Then SEM carried out to show the changes between control and
exposed parasites.

Results:

The greatest mortality rate was seen in 20 ppm concentration and after 120 minutes of exposure. By
electron microscopy, the structural changes were seen in tachyzoites of RH and tissue cyst of Tehran
strain in comparison with control groups.

Conclusion:

Nanosilver colloid was effective on both tachyzoites and bradyzoites of T. gondii, RH and Tehran
strains.

TRIQUETRA®

COLEOIDAL

SILVER

——
BIOACTIVE FORM — NANO CONCENTRATE

Effective against internal parasites. Effective against external parasites.

179

you should oh didnt know that
de-worm

The virgin de-woomer THE CHAD VERME CTIN HONKLER

Eating for six gorillion, still skinny
No thoughts or creativity.

Takes every thing at face value HAS FULLY SEEN THE SERPENT

smiles while reading parasite threads

A colony lives in him Can't cope with wormworld

Defeatist No honks Effortlessly btfos entire WIDF Squads
worm world has to live with him
Never Jabbed
worried about gay anal worms Pure Blood
Vaxxed Parasite Free
Smells like apples and tobacco
PP Sneed and Feed
is a mindless drone to the hive refused ascension to shit post in the material realm with the boys

180